Incidental Mutation 'R0826:Clasrp'
ID78226
Institutional Source Beutler Lab
Gene Symbol Clasrp
Ensembl Gene ENSMUSG00000061028
Gene NameCLK4-associating serine/arginine rich protein
SynonymsSrsf16, Sfrs16, SWAP2
MMRRC Submission 039006-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0826 (G1)
Quality Score159
Status Validated
Chromosome7
Chromosomal Location19581035-19604486 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) G to T at 19584301 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086041] [ENSMUST00000108453] [ENSMUST00000207524] [ENSMUST00000207663] [ENSMUST00000207907] [ENSMUST00000208068]
Predicted Effect unknown
Transcript: ENSMUST00000086041
AA Change: Q598K
SMART Domains Protein: ENSMUSP00000083205
Gene: ENSMUSG00000061028
AA Change: Q598K

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
DRY_EERY 39 171 1.28e-64 SMART
low complexity region 172 212 N/A INTRINSIC
low complexity region 241 260 N/A INTRINSIC
low complexity region 263 283 N/A INTRINSIC
low complexity region 302 324 N/A INTRINSIC
low complexity region 339 368 N/A INTRINSIC
low complexity region 372 446 N/A INTRINSIC
low complexity region 453 476 N/A INTRINSIC
low complexity region 480 532 N/A INTRINSIC
coiled coil region 574 630 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108453
SMART Domains Protein: ENSMUSP00000104093
Gene: ENSMUSG00000011267

DomainStartEndE-ValueType
ZnF_C2H2 138 161 5.07e0 SMART
ZnF_C2H2 212 234 2.05e-2 SMART
ZnF_C2H2 240 262 1.1e-2 SMART
low complexity region 281 295 N/A INTRINSIC
low complexity region 317 329 N/A INTRINSIC
ZnF_C2H2 360 382 1.95e-3 SMART
ZnF_C2H2 388 410 3.39e-3 SMART
ZnF_C2H2 418 441 1.14e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207447
Predicted Effect probably benign
Transcript: ENSMUST00000207524
Predicted Effect probably benign
Transcript: ENSMUST00000207663
Predicted Effect probably benign
Transcript: ENSMUST00000207907
Predicted Effect probably benign
Transcript: ENSMUST00000208068
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208716
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209059
Meta Mutation Damage Score 0.232 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.6%
  • 10x: 95.7%
  • 20x: 86.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: The protein encoded by this gene contains serine/arginine (SR) dipeptide repeat domains, and is thought to be involved in the regulation of alternative splicing. This protein is thought to interact with, and be phosphorylated by, Clk4. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4930563D23Rik G A 16: 92,321,187 S71L probably benign Het
4931406C07Rik T C 9: 15,291,996 probably null Het
Adamts16 T A 13: 70,768,692 D727V possibly damaging Het
Anxa10 A C 8: 62,076,284 L133* probably null Het
Arfgef3 G A 10: 18,589,666 T2143I probably damaging Het
Arhgef17 T C 7: 100,930,743 T333A probably benign Het
Arhgef40 A G 14: 52,000,993 T1310A probably benign Het
Atg10 C T 13: 90,936,586 probably null Het
Atp1a1 A G 3: 101,584,853 F569S probably damaging Het
Baiap3 A G 17: 25,245,229 W849R possibly damaging Het
Baz1a A T 12: 54,930,312 Y9* probably null Het
Catsperg2 C T 7: 29,705,624 D702N possibly damaging Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Col19a1 T C 1: 24,526,386 K288R unknown Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cttnbp2 A G 6: 18,405,178 probably benign Het
Dnah1 T A 14: 31,303,907 I828F probably benign Het
Dpf2 G T 19: 5,907,127 Q23K probably damaging Het
Dsc3 T A 18: 19,981,172 I342F probably damaging Het
Enpp3 A G 10: 24,795,716 L460P probably damaging Het
Epb41l2 A G 10: 25,504,192 E871G probably damaging Het
Exoc2 T C 13: 30,856,797 probably null Het
Fpr-rs7 A T 17: 20,113,626 S201T probably benign Het
Gtf2ird2 T C 5: 134,216,955 F685S probably damaging Het
Helz2 C T 2: 181,240,853 R49H possibly damaging Het
Ica1 A G 6: 8,667,375 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kif21a A G 15: 90,997,541 probably null Het
Lamb3 T A 1: 193,330,908 C480* probably null Het
Lamc2 A G 1: 153,152,082 S199P probably damaging Het
Lrfn3 T C 7: 30,360,251 N183S probably benign Het
Lsm14a C A 7: 34,371,045 probably benign Het
Mest C A 6: 30,742,814 H146Q probably damaging Het
Mmp27 T C 9: 7,579,009 V339A probably damaging Het
Myo16 T C 8: 10,376,285 probably benign Het
Myoz1 C T 14: 20,653,611 probably benign Het
Nlrp5 A G 7: 23,417,708 M286V probably benign Het
Olfr1250 A C 2: 89,656,837 N201K possibly damaging Het
Olfr1386 A T 11: 49,470,331 Y60F probably damaging Het
Olfr1537 C T 9: 39,238,429 M1I probably null Het
Olfr273 C T 4: 52,855,566 V316I probably benign Het
Optc T C 1: 133,905,155 K69R probably benign Het
Osbpl3 A T 6: 50,346,377 M242K probably damaging Het
Pdzd9 T A 7: 120,668,401 S64C probably damaging Het
Pik3cg A G 12: 32,195,673 S859P possibly damaging Het
Ppp1r12a G T 10: 108,230,553 A202S possibly damaging Het
Rab32 A T 10: 10,550,867 F112I possibly damaging Het
Ror2 T C 13: 53,113,217 Y394C probably damaging Het
Rtn3 A G 19: 7,467,880 probably benign Het
Sbk1 C T 7: 126,291,835 P147L probably damaging Het
Shpk T A 11: 73,204,031 M91K probably damaging Het
Slco6c1 C T 1: 97,128,101 S25N probably benign Het
Snx2 A T 18: 53,194,522 T107S probably benign Het
Tle2 G A 10: 81,586,314 V397I possibly damaging Het
Tmem131l T C 3: 83,898,417 D1573G probably damaging Het
Tnfrsf8 A G 4: 145,285,138 probably benign Het
Tpmt T C 13: 47,041,489 E36G probably benign Het
Trim30c T A 7: 104,383,481 T257S probably benign Het
Tsc2 A G 17: 24,596,958 L150P probably benign Het
Ttc26 A G 6: 38,425,114 probably null Het
Upf3a G C 8: 13,798,338 G378A possibly damaging Het
Yeats2 A T 16: 20,193,216 K514* probably null Het
Zfp11 A G 5: 129,657,525 Y291H probably benign Het
Zfp457 T C 13: 67,293,314 D399G possibly damaging Het
Other mutations in Clasrp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02394:Clasrp APN 7 19603254 missense probably damaging 1.00
clarissa UTSW 7 19590248 missense possibly damaging 0.82
suet UTSW 7 19586468 utr 3 prime probably benign
R0518:Clasrp UTSW 7 19588603 missense probably benign 0.32
R0519:Clasrp UTSW 7 19584164 utr 3 prime probably benign
R0521:Clasrp UTSW 7 19588603 missense probably benign 0.32
R0626:Clasrp UTSW 7 19584493 utr 3 prime probably benign
R1918:Clasrp UTSW 7 19585263 nonsense probably null
R2044:Clasrp UTSW 7 19586715 utr 3 prime probably benign
R2256:Clasrp UTSW 7 19586585 utr 3 prime probably benign
R2257:Clasrp UTSW 7 19586585 utr 3 prime probably benign
R2870:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R2870:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R2871:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R2871:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R2940:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R3408:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R3691:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R4168:Clasrp UTSW 7 19581154 unclassified probably benign
R4496:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R4505:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R4507:Clasrp UTSW 7 19585240 utr 3 prime probably benign
R4572:Clasrp UTSW 7 19584464 splice site probably null
R4753:Clasrp UTSW 7 19594940 missense probably damaging 1.00
R4871:Clasrp UTSW 7 19590248 missense possibly damaging 0.82
R4938:Clasrp UTSW 7 19584778 splice site probably null
R5538:Clasrp UTSW 7 19584782 utr 3 prime probably benign
R5582:Clasrp UTSW 7 19586856 missense probably damaging 0.97
R5615:Clasrp UTSW 7 19586447 utr 3 prime probably benign
R5794:Clasrp UTSW 7 19591109 missense probably damaging 0.99
R5944:Clasrp UTSW 7 19594506 missense probably damaging 1.00
R6102:Clasrp UTSW 7 19586468 utr 3 prime probably benign
R6171:Clasrp UTSW 7 19584822 splice site probably benign
R6485:Clasrp UTSW 7 19586369 utr 3 prime probably benign
R6600:Clasrp UTSW 7 19590282 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGCAATGGCAATGGATTTCAGGAC -3'
(R):5'- AAGGCTCTGAACCGCCAGTGTAAG -3'

Sequencing Primer
(F):5'- CAATGGATTTCAGGACCAGTG -3'
(R):5'- AACCGCCAGTGTAAGTCCTG -3'
Posted On2013-10-16