Incidental Mutation 'R0826:Epb41l2'
ID78244
Institutional Source Beutler Lab
Gene Symbol Epb41l2
Ensembl Gene ENSMUSG00000019978
Gene Nameerythrocyte membrane protein band 4.1 like 2
SynonymsNBL2, 4.1G, Epb4.1l2, D10Ertd398e
MMRRC Submission 039006-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.414) question?
Stock #R0826 (G1)
Quality Score181
Status Validated
Chromosome10
Chromosomal Location25359798-25523519 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25504192 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 871 (E871G)
Ref Sequence ENSEMBL: ENSMUSP00000090314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053748] [ENSMUST00000092645] [ENSMUST00000217929] [ENSMUST00000217943] [ENSMUST00000218903] [ENSMUST00000220290]
Predicted Effect probably damaging
Transcript: ENSMUST00000053748
AA Change: E871G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055122
Gene: ENSMUSG00000019978
AA Change: E871G

DomainStartEndE-ValueType
B41 207 402 3.22e-76 SMART
FERM_C 406 496 2.15e-39 SMART
FA 499 545 1.93e-18 SMART
low complexity region 555 567 N/A INTRINSIC
Pfam:SAB 613 661 1.8e-23 PFAM
low complexity region 717 733 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
Pfam:4_1_CTD 875 981 1.1e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092645
AA Change: E871G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090314
Gene: ENSMUSG00000019978
AA Change: E871G

DomainStartEndE-ValueType
B41 207 402 3.22e-76 SMART
FERM_C 406 496 2.15e-39 SMART
FA 499 545 1.93e-18 SMART
low complexity region 555 567 N/A INTRINSIC
Pfam:SAB 613 661 6.1e-27 PFAM
low complexity region 717 733 N/A INTRINSIC
low complexity region 751 763 N/A INTRINSIC
Pfam:4_1_CTD 869 982 8.2e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217844
Predicted Effect probably benign
Transcript: ENSMUST00000217929
Predicted Effect probably benign
Transcript: ENSMUST00000217943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218345
Predicted Effect probably damaging
Transcript: ENSMUST00000218903
AA Change: E801G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219138
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219201
Predicted Effect probably benign
Transcript: ENSMUST00000219372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219941
Predicted Effect probably damaging
Transcript: ENSMUST00000220290
AA Change: E117G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.538 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.6%
  • 10x: 95.7%
  • 20x: 86.3%
Validation Efficiency 100% (69/69)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal glutamatergic synapse formation, AMPAR responses and long-term potentiation. Male mice homozygous for a knock-out allele exhibit normal fertility. Male mice homozygous for a gene trap allele on a mixed background are infertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4930563D23Rik G A 16: 92,321,187 S71L probably benign Het
4931406C07Rik T C 9: 15,291,996 probably null Het
Adamts16 T A 13: 70,768,692 D727V possibly damaging Het
Anxa10 A C 8: 62,076,284 L133* probably null Het
Arfgef3 G A 10: 18,589,666 T2143I probably damaging Het
Arhgef17 T C 7: 100,930,743 T333A probably benign Het
Arhgef40 A G 14: 52,000,993 T1310A probably benign Het
Atg10 C T 13: 90,936,586 probably null Het
Atp1a1 A G 3: 101,584,853 F569S probably damaging Het
Baiap3 A G 17: 25,245,229 W849R possibly damaging Het
Baz1a A T 12: 54,930,312 Y9* probably null Het
Catsperg2 C T 7: 29,705,624 D702N possibly damaging Het
Clasrp G T 7: 19,584,301 probably benign Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Col19a1 T C 1: 24,526,386 K288R unknown Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cttnbp2 A G 6: 18,405,178 probably benign Het
Dnah1 T A 14: 31,303,907 I828F probably benign Het
Dpf2 G T 19: 5,907,127 Q23K probably damaging Het
Dsc3 T A 18: 19,981,172 I342F probably damaging Het
Enpp3 A G 10: 24,795,716 L460P probably damaging Het
Exoc2 T C 13: 30,856,797 probably null Het
Fpr-rs7 A T 17: 20,113,626 S201T probably benign Het
Gtf2ird2 T C 5: 134,216,955 F685S probably damaging Het
Helz2 C T 2: 181,240,853 R49H possibly damaging Het
Ica1 A G 6: 8,667,375 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kif21a A G 15: 90,997,541 probably null Het
Lamb3 T A 1: 193,330,908 C480* probably null Het
Lamc2 A G 1: 153,152,082 S199P probably damaging Het
Lrfn3 T C 7: 30,360,251 N183S probably benign Het
Lsm14a C A 7: 34,371,045 probably benign Het
Mest C A 6: 30,742,814 H146Q probably damaging Het
Mmp27 T C 9: 7,579,009 V339A probably damaging Het
Myo16 T C 8: 10,376,285 probably benign Het
Myoz1 C T 14: 20,653,611 probably benign Het
Nlrp5 A G 7: 23,417,708 M286V probably benign Het
Olfr1250 A C 2: 89,656,837 N201K possibly damaging Het
Olfr1386 A T 11: 49,470,331 Y60F probably damaging Het
Olfr1537 C T 9: 39,238,429 M1I probably null Het
Olfr273 C T 4: 52,855,566 V316I probably benign Het
Optc T C 1: 133,905,155 K69R probably benign Het
Osbpl3 A T 6: 50,346,377 M242K probably damaging Het
Pdzd9 T A 7: 120,668,401 S64C probably damaging Het
Pik3cg A G 12: 32,195,673 S859P possibly damaging Het
Ppp1r12a G T 10: 108,230,553 A202S possibly damaging Het
Rab32 A T 10: 10,550,867 F112I possibly damaging Het
Ror2 T C 13: 53,113,217 Y394C probably damaging Het
Rtn3 A G 19: 7,467,880 probably benign Het
Sbk1 C T 7: 126,291,835 P147L probably damaging Het
Shpk T A 11: 73,204,031 M91K probably damaging Het
Slco6c1 C T 1: 97,128,101 S25N probably benign Het
Snx2 A T 18: 53,194,522 T107S probably benign Het
Tle2 G A 10: 81,586,314 V397I possibly damaging Het
Tmem131l T C 3: 83,898,417 D1573G probably damaging Het
Tnfrsf8 A G 4: 145,285,138 probably benign Het
Tpmt T C 13: 47,041,489 E36G probably benign Het
Trim30c T A 7: 104,383,481 T257S probably benign Het
Tsc2 A G 17: 24,596,958 L150P probably benign Het
Ttc26 A G 6: 38,425,114 probably null Het
Upf3a G C 8: 13,798,338 G378A possibly damaging Het
Yeats2 A T 16: 20,193,216 K514* probably null Het
Zfp11 A G 5: 129,657,525 Y291H probably benign Het
Zfp457 T C 13: 67,293,314 D399G possibly damaging Het
Other mutations in Epb41l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Epb41l2 APN 10 25501836 missense probably damaging 1.00
IGL00826:Epb41l2 APN 10 25441722 missense probably benign 0.07
IGL01312:Epb41l2 APN 10 25441587 start codon destroyed probably null 1.00
IGL02123:Epb41l2 APN 10 25460844 missense probably damaging 1.00
IGL02448:Epb41l2 APN 10 25493595 missense possibly damaging 0.66
R0365:Epb41l2 UTSW 10 25469221 missense probably damaging 1.00
R0594:Epb41l2 UTSW 10 25443770 missense possibly damaging 0.53
R0837:Epb41l2 UTSW 10 25507816 missense probably damaging 1.00
R1243:Epb41l2 UTSW 10 25489043 missense possibly damaging 0.81
R1301:Epb41l2 UTSW 10 25443902 missense probably damaging 1.00
R1560:Epb41l2 UTSW 10 25495436 splice site probably null
R1752:Epb41l2 UTSW 10 25460792 missense probably damaging 1.00
R1813:Epb41l2 UTSW 10 25441568 splice site probably null
R1966:Epb41l2 UTSW 10 25441768 missense probably benign 0.01
R2276:Epb41l2 UTSW 10 25488944 unclassified probably benign
R4425:Epb41l2 UTSW 10 25506180 missense possibly damaging 0.81
R4445:Epb41l2 UTSW 10 25443803 missense possibly damaging 0.92
R4621:Epb41l2 UTSW 10 25502140 critical splice donor site probably null
R4720:Epb41l2 UTSW 10 25471626 missense probably damaging 1.00
R5026:Epb41l2 UTSW 10 25484308 missense possibly damaging 0.94
R5408:Epb41l2 UTSW 10 25468094 critical splice acceptor site probably null
R5703:Epb41l2 UTSW 10 25441767 missense probably damaging 1.00
R5896:Epb41l2 UTSW 10 25493596 missense probably damaging 0.96
R5974:Epb41l2 UTSW 10 25441815 missense possibly damaging 0.79
R6073:Epb41l2 UTSW 10 25501832 missense probably damaging 1.00
R6182:Epb41l2 UTSW 10 25507817 missense probably damaging 1.00
R6229:Epb41l2 UTSW 10 25499836 missense possibly damaging 0.73
R6276:Epb41l2 UTSW 10 25502124 missense probably damaging 0.98
R6321:Epb41l2 UTSW 10 25468128 missense probably damaging 0.98
R6737:Epb41l2 UTSW 10 25489018 unclassified probably null
R6766:Epb41l2 UTSW 10 25473092 nonsense probably null
R6834:Epb41l2 UTSW 10 25493604 missense possibly damaging 0.92
R7023:Epb41l2 UTSW 10 25512977 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTTAGGACCAGCACAGTCTGAAG -3'
(R):5'- GTTCTATCAAAGCCAGGAACAGGGG -3'

Sequencing Primer
(F):5'- GTTAGCTTAGCTTAGCTTAgtatgtg -3'
(R):5'- CAGGGGAAGACACTGAACAC -3'
Posted On2013-10-16