Incidental Mutation 'R0826:Ppp1r12a'
ID78246
Institutional Source Beutler Lab
Gene Symbol Ppp1r12a
Ensembl Gene ENSMUSG00000019907
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 12A
Synonyms1200015F06Rik, 5730577I22Rik, Mypt1, D10Ertd625e
MMRRC Submission 039006-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0826 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location108162193-108284475 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 108230553 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 202 (A202S)
Ref Sequence ENSEMBL: ENSMUSP00000151842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070663] [ENSMUST00000219263]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070663
AA Change: A202S

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000069257
Gene: ENSMUSG00000019907
AA Change: A202S

DomainStartEndE-ValueType
ANK 38 68 1.01e2 SMART
ANK 72 101 1.66e-6 SMART
ANK 105 134 6.36e-3 SMART
ANK 138 168 5.52e2 SMART
ANK 198 227 6.12e-5 SMART
ANK 231 260 5.16e-3 SMART
coiled coil region 333 354 N/A INTRINSIC
low complexity region 385 402 N/A INTRINSIC
low complexity region 469 480 N/A INTRINSIC
low complexity region 517 531 N/A INTRINSIC
low complexity region 564 578 N/A INTRINSIC
low complexity region 596 610 N/A INTRINSIC
low complexity region 626 656 N/A INTRINSIC
PDB:2KJY|A 657 712 5e-12 PDB
low complexity region 719 745 N/A INTRINSIC
low complexity region 771 794 N/A INTRINSIC
low complexity region 815 833 N/A INTRINSIC
low complexity region 836 851 N/A INTRINSIC
low complexity region 883 902 N/A INTRINSIC
Pfam:PRKG1_interact 930 993 4.5e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000219263
AA Change: A202S

PolyPhen 2 Score 0.459 (Sensitivity: 0.89; Specificity: 0.90)
Meta Mutation Damage Score 0.192 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.6%
  • 10x: 95.7%
  • 20x: 86.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myosin phosphatase target subunit 1, which is also called the myosin-binding subunit of myosin phosphatase, is one of the subunits of myosin phosphatase. Myosin phosphatase regulates the interaction of actin and myosin downstream of the guanosine triphosphatase Rho. The small guanosine triphosphatase Rho is implicated in myosin light chain (MLC) phosphorylation, which results in contraction of smooth muscle and interaction of actin and myosin in nonmuscle cells. The guanosine triphosphate (GTP)-bound, active form of RhoA (GTP.RhoA) specifically interacted with the myosin-binding subunit (MBS) of myosin phosphatase, which regulates the extent of phosphorylation of MLC. Rho-associated kinase (Rho-kinase), which is activated by GTP. RhoA, phosphorylated MBS and consequently inactivated myosin phosphatase. Overexpression of RhoA or activated RhoA in NIH 3T3 cells increased phosphorylation of MBS and MLC. Thus, Rho appears to inhibit myosin phosphatase through the action of Rho-kinase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous null mice die before E7.5. Mice homozygous for a floxed allele activated in smooth muscle exhibit altered intestinal smooth muscle contractility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4930563D23Rik G A 16: 92,321,187 S71L probably benign Het
4931406C07Rik T C 9: 15,291,996 probably null Het
Adamts16 T A 13: 70,768,692 D727V possibly damaging Het
Anxa10 A C 8: 62,076,284 L133* probably null Het
Arfgef3 G A 10: 18,589,666 T2143I probably damaging Het
Arhgef17 T C 7: 100,930,743 T333A probably benign Het
Arhgef40 A G 14: 52,000,993 T1310A probably benign Het
Atg10 C T 13: 90,936,586 probably null Het
Atp1a1 A G 3: 101,584,853 F569S probably damaging Het
Baiap3 A G 17: 25,245,229 W849R possibly damaging Het
Baz1a A T 12: 54,930,312 Y9* probably null Het
Catsperg2 C T 7: 29,705,624 D702N possibly damaging Het
Clasrp G T 7: 19,584,301 probably benign Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Col19a1 T C 1: 24,526,386 K288R unknown Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cttnbp2 A G 6: 18,405,178 probably benign Het
Dnah1 T A 14: 31,303,907 I828F probably benign Het
Dpf2 G T 19: 5,907,127 Q23K probably damaging Het
Dsc3 T A 18: 19,981,172 I342F probably damaging Het
Enpp3 A G 10: 24,795,716 L460P probably damaging Het
Epb41l2 A G 10: 25,504,192 E871G probably damaging Het
Exoc2 T C 13: 30,856,797 probably null Het
Fpr-rs7 A T 17: 20,113,626 S201T probably benign Het
Gtf2ird2 T C 5: 134,216,955 F685S probably damaging Het
Helz2 C T 2: 181,240,853 R49H possibly damaging Het
Ica1 A G 6: 8,667,375 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kif21a A G 15: 90,997,541 probably null Het
Lamb3 T A 1: 193,330,908 C480* probably null Het
Lamc2 A G 1: 153,152,082 S199P probably damaging Het
Lrfn3 T C 7: 30,360,251 N183S probably benign Het
Lsm14a C A 7: 34,371,045 probably benign Het
Mest C A 6: 30,742,814 H146Q probably damaging Het
Mmp27 T C 9: 7,579,009 V339A probably damaging Het
Myo16 T C 8: 10,376,285 probably benign Het
Myoz1 C T 14: 20,653,611 probably benign Het
Nlrp5 A G 7: 23,417,708 M286V probably benign Het
Olfr1250 A C 2: 89,656,837 N201K possibly damaging Het
Olfr1386 A T 11: 49,470,331 Y60F probably damaging Het
Olfr1537 C T 9: 39,238,429 M1I probably null Het
Olfr273 C T 4: 52,855,566 V316I probably benign Het
Optc T C 1: 133,905,155 K69R probably benign Het
Osbpl3 A T 6: 50,346,377 M242K probably damaging Het
Pdzd9 T A 7: 120,668,401 S64C probably damaging Het
Pik3cg A G 12: 32,195,673 S859P possibly damaging Het
Rab32 A T 10: 10,550,867 F112I possibly damaging Het
Ror2 T C 13: 53,113,217 Y394C probably damaging Het
Rtn3 A G 19: 7,467,880 probably benign Het
Sbk1 C T 7: 126,291,835 P147L probably damaging Het
Shpk T A 11: 73,204,031 M91K probably damaging Het
Slco6c1 C T 1: 97,128,101 S25N probably benign Het
Snx2 A T 18: 53,194,522 T107S probably benign Het
Tle2 G A 10: 81,586,314 V397I possibly damaging Het
Tmem131l T C 3: 83,898,417 D1573G probably damaging Het
Tnfrsf8 A G 4: 145,285,138 probably benign Het
Tpmt T C 13: 47,041,489 E36G probably benign Het
Trim30c T A 7: 104,383,481 T257S probably benign Het
Tsc2 A G 17: 24,596,958 L150P probably benign Het
Ttc26 A G 6: 38,425,114 probably null Het
Upf3a G C 8: 13,798,338 G378A possibly damaging Het
Yeats2 A T 16: 20,193,216 K514* probably null Het
Zfp11 A G 5: 129,657,525 Y291H probably benign Het
Zfp457 T C 13: 67,293,314 D399G possibly damaging Het
Other mutations in Ppp1r12a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Ppp1r12a APN 10 108198848 missense probably damaging 1.00
IGL00727:Ppp1r12a APN 10 108230473 missense probably damaging 1.00
IGL00819:Ppp1r12a APN 10 108240821 missense probably damaging 0.98
IGL01538:Ppp1r12a APN 10 108234021 missense probably damaging 1.00
IGL02227:Ppp1r12a APN 10 108269324 missense probably damaging 1.00
IGL02957:Ppp1r12a APN 10 108198918 missense probably damaging 0.98
IGL03063:Ppp1r12a APN 10 108261254 missense probably damaging 1.00
IGL03260:Ppp1r12a APN 10 108261245 missense probably benign 0.10
R0049:Ppp1r12a UTSW 10 108253332 missense possibly damaging 0.63
R0268:Ppp1r12a UTSW 10 108273381 intron probably benign
R0839:Ppp1r12a UTSW 10 108198861 missense probably damaging 1.00
R1026:Ppp1r12a UTSW 10 108251859 missense probably benign 0.08
R1053:Ppp1r12a UTSW 10 108262351 missense probably damaging 1.00
R1376:Ppp1r12a UTSW 10 108198918 missense probably damaging 0.98
R1376:Ppp1r12a UTSW 10 108198918 missense probably damaging 0.98
R1511:Ppp1r12a UTSW 10 108251859 missense probably benign 0.08
R1616:Ppp1r12a UTSW 10 108260867 missense probably damaging 1.00
R1673:Ppp1r12a UTSW 10 108249565 missense probably damaging 0.96
R1866:Ppp1r12a UTSW 10 108262431 missense possibly damaging 0.85
R1901:Ppp1r12a UTSW 10 108198891 missense probably damaging 1.00
R1902:Ppp1r12a UTSW 10 108198891 missense probably damaging 1.00
R2233:Ppp1r12a UTSW 10 108198919 missense possibly damaging 0.83
R2234:Ppp1r12a UTSW 10 108198919 missense possibly damaging 0.83
R3760:Ppp1r12a UTSW 10 108264734 missense probably damaging 1.00
R3856:Ppp1r12a UTSW 10 108253501 intron probably benign
R3973:Ppp1r12a UTSW 10 108253480 missense probably benign 0.44
R3974:Ppp1r12a UTSW 10 108253480 missense probably benign 0.44
R3976:Ppp1r12a UTSW 10 108253480 missense probably benign 0.44
R4502:Ppp1r12a UTSW 10 108249478 missense probably benign 0.26
R4902:Ppp1r12a UTSW 10 108230590 missense probably damaging 1.00
R5092:Ppp1r12a UTSW 10 108267402 critical splice acceptor site probably null
R5224:Ppp1r12a UTSW 10 108261025 missense probably benign 0.37
R5353:Ppp1r12a UTSW 10 108261216 intron probably null
R5428:Ppp1r12a UTSW 10 108253347 missense possibly damaging 0.76
R5472:Ppp1r12a UTSW 10 108240112 missense probably damaging 1.00
R5510:Ppp1r12a UTSW 10 108249627 missense possibly damaging 0.82
R6217:Ppp1r12a UTSW 10 108240184 splice site probably null
R6274:Ppp1r12a UTSW 10 108260890 missense probably benign 0.00
R6431:Ppp1r12a UTSW 10 108262420 missense probably damaging 1.00
R6744:Ppp1r12a UTSW 10 108230534 missense probably damaging 1.00
R6838:Ppp1r12a UTSW 10 108261276 missense possibly damaging 0.76
R6865:Ppp1r12a UTSW 10 108262381 nonsense probably null
R6993:Ppp1r12a UTSW 10 108240837 missense probably benign 0.18
X0027:Ppp1r12a UTSW 10 108214423 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCAATCAGAAGGCATAACCACACT -3'
(R):5'- CATGGGAACTGCCAATGACTCGAA -3'

Sequencing Primer
(F):5'- tccagaggcagaggcag -3'
(R):5'- TCAGTGTGACAGGTAACATATAATGG -3'
Posted On2013-10-16