Incidental Mutation 'R0826:Dnah1'
ID78258
Institutional Source Beutler Lab
Gene Symbol Dnah1
Ensembl Gene ENSMUSG00000019027
Gene Namedynein, axonemal, heavy chain 1
SynonymsE030034C22Rik, MDHC7, Dnahc1, B230373P09Rik
MMRRC Submission 039006-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0826 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location31260375-31323896 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31303907 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 828 (I828F)
Ref Sequence ENSEMBL: ENSMUSP00000043281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048603]
Predicted Effect probably benign
Transcript: ENSMUST00000048603
AA Change: I828F

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000043281
Gene: ENSMUSG00000019027
AA Change: I828F

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DHC_N2 998 1404 6.3e-146 PFAM
AAA 1558 1697 6.02e-1 SMART
AAA 1839 2077 4.66e0 SMART
low complexity region 2149 2157 N/A INTRINSIC
AAA 2204 2353 2.35e-1 SMART
Pfam:AAA_8 2533 2803 7.7e-84 PFAM
Pfam:MT 2815 3165 9.9e-57 PFAM
Pfam:AAA_9 3185 3410 1.1e-93 PFAM
Pfam:Dynein_heavy 3545 4246 2.7e-275 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228755
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.6%
  • 10x: 95.7%
  • 20x: 86.3%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an inner dynein arm heavy chain that provides structural support between the radial spokes and the outer doublet of the sperm tail. Naturally occurring mutations in this gene are associated with primary ciliary dyskinesia and multiple morphological anomalies of the flagella that result in asthenozoospermia and male infertility. Mice with a homozygous knockout of the orthologous gene are viable but have reduced sperm motility and are infertile. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous mutants are male sterile, and show impaired ciliary and flagellar motility that is also observed in the tracheal cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4930563D23Rik G A 16: 92,321,187 S71L probably benign Het
4931406C07Rik T C 9: 15,291,996 probably null Het
Adamts16 T A 13: 70,768,692 D727V possibly damaging Het
Anxa10 A C 8: 62,076,284 L133* probably null Het
Arfgef3 G A 10: 18,589,666 T2143I probably damaging Het
Arhgef17 T C 7: 100,930,743 T333A probably benign Het
Arhgef40 A G 14: 52,000,993 T1310A probably benign Het
Atg10 C T 13: 90,936,586 probably null Het
Atp1a1 A G 3: 101,584,853 F569S probably damaging Het
Baiap3 A G 17: 25,245,229 W849R possibly damaging Het
Baz1a A T 12: 54,930,312 Y9* probably null Het
Catsperg2 C T 7: 29,705,624 D702N possibly damaging Het
Clasrp G T 7: 19,584,301 probably benign Het
Col11a1 G A 3: 114,138,765 R113H unknown Het
Col19a1 T C 1: 24,526,386 K288R unknown Het
Ctnnbl1 C T 2: 157,799,417 probably benign Het
Cttnbp2 A G 6: 18,405,178 probably benign Het
Dpf2 G T 19: 5,907,127 Q23K probably damaging Het
Dsc3 T A 18: 19,981,172 I342F probably damaging Het
Enpp3 A G 10: 24,795,716 L460P probably damaging Het
Epb41l2 A G 10: 25,504,192 E871G probably damaging Het
Exoc2 T C 13: 30,856,797 probably null Het
Fpr-rs7 A T 17: 20,113,626 S201T probably benign Het
Gtf2ird2 T C 5: 134,216,955 F685S probably damaging Het
Helz2 C T 2: 181,240,853 R49H possibly damaging Het
Ica1 A G 6: 8,667,375 probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kif21a A G 15: 90,997,541 probably null Het
Lamb3 T A 1: 193,330,908 C480* probably null Het
Lamc2 A G 1: 153,152,082 S199P probably damaging Het
Lrfn3 T C 7: 30,360,251 N183S probably benign Het
Lsm14a C A 7: 34,371,045 probably benign Het
Mest C A 6: 30,742,814 H146Q probably damaging Het
Mmp27 T C 9: 7,579,009 V339A probably damaging Het
Myo16 T C 8: 10,376,285 probably benign Het
Myoz1 C T 14: 20,653,611 probably benign Het
Nlrp5 A G 7: 23,417,708 M286V probably benign Het
Olfr1250 A C 2: 89,656,837 N201K possibly damaging Het
Olfr1386 A T 11: 49,470,331 Y60F probably damaging Het
Olfr1537 C T 9: 39,238,429 M1I probably null Het
Olfr273 C T 4: 52,855,566 V316I probably benign Het
Optc T C 1: 133,905,155 K69R probably benign Het
Osbpl3 A T 6: 50,346,377 M242K probably damaging Het
Pdzd9 T A 7: 120,668,401 S64C probably damaging Het
Pik3cg A G 12: 32,195,673 S859P possibly damaging Het
Ppp1r12a G T 10: 108,230,553 A202S possibly damaging Het
Rab32 A T 10: 10,550,867 F112I possibly damaging Het
Ror2 T C 13: 53,113,217 Y394C probably damaging Het
Rtn3 A G 19: 7,467,880 probably benign Het
Sbk1 C T 7: 126,291,835 P147L probably damaging Het
Shpk T A 11: 73,204,031 M91K probably damaging Het
Slco6c1 C T 1: 97,128,101 S25N probably benign Het
Snx2 A T 18: 53,194,522 T107S probably benign Het
Tle2 G A 10: 81,586,314 V397I possibly damaging Het
Tmem131l T C 3: 83,898,417 D1573G probably damaging Het
Tnfrsf8 A G 4: 145,285,138 probably benign Het
Tpmt T C 13: 47,041,489 E36G probably benign Het
Trim30c T A 7: 104,383,481 T257S probably benign Het
Tsc2 A G 17: 24,596,958 L150P probably benign Het
Ttc26 A G 6: 38,425,114 probably null Het
Upf3a G C 8: 13,798,338 G378A possibly damaging Het
Yeats2 A T 16: 20,193,216 K514* probably null Het
Zfp11 A G 5: 129,657,525 Y291H probably benign Het
Zfp457 T C 13: 67,293,314 D399G possibly damaging Het
Other mutations in Dnah1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Dnah1 APN 14 31287873 missense probably benign 0.01
IGL00227:Dnah1 APN 14 31286896 missense probably damaging 1.00
IGL00491:Dnah1 APN 14 31261839 missense probably damaging 1.00
IGL00787:Dnah1 APN 14 31300063 missense possibly damaging 0.91
IGL00809:Dnah1 APN 14 31300809 nonsense probably null
IGL00911:Dnah1 APN 14 31304434 splice site probably null
IGL00949:Dnah1 APN 14 31307090 missense probably benign 0.00
IGL00976:Dnah1 APN 14 31278138 missense probably damaging 1.00
IGL01484:Dnah1 APN 14 31299940 missense probably damaging 0.98
IGL01629:Dnah1 APN 14 31292320 missense probably damaging 1.00
IGL01716:Dnah1 APN 14 31263378 missense probably benign 0.34
IGL01893:Dnah1 APN 14 31266470 missense probably damaging 1.00
IGL01933:Dnah1 APN 14 31310915 missense probably benign 0.40
IGL01938:Dnah1 APN 14 31283887 missense probably benign
IGL02032:Dnah1 APN 14 31274369 missense probably benign
IGL02052:Dnah1 APN 14 31268786 missense probably damaging 0.99
IGL02097:Dnah1 APN 14 31305001 missense possibly damaging 0.92
IGL02127:Dnah1 APN 14 31304928 missense probably benign 0.00
IGL02143:Dnah1 APN 14 31283289 missense probably damaging 1.00
IGL02158:Dnah1 APN 14 31300967 missense probably benign 0.00
IGL02442:Dnah1 APN 14 31287878 missense probably damaging 1.00
IGL02525:Dnah1 APN 14 31305833 missense probably benign 0.05
IGL02558:Dnah1 APN 14 31274379 missense possibly damaging 0.96
IGL02633:Dnah1 APN 14 31284815 missense probably benign 0.05
IGL02720:Dnah1 APN 14 31262220 missense probably damaging 0.96
IGL02728:Dnah1 APN 14 31283998 missense probably benign 0.44
IGL02738:Dnah1 APN 14 31292640 missense probably benign 0.27
IGL02863:Dnah1 APN 14 31295293 missense probably damaging 0.99
IGL02944:Dnah1 APN 14 31300871 missense possibly damaging 0.88
IGL03110:Dnah1 APN 14 31266717 missense probably benign 0.40
IGL03201:Dnah1 APN 14 31300949 missense probably benign 0.13
IGL03215:Dnah1 APN 14 31274391 missense probably damaging 1.00
IGL03230:Dnah1 APN 14 31270066 missense probably damaging 1.00
IGL03248:Dnah1 APN 14 31269889 missense probably damaging 1.00
IGL03267:Dnah1 APN 14 31286588 missense probably benign 0.00
IGL03299:Dnah1 APN 14 31315122 nonsense probably null
IGL03301:Dnah1 APN 14 31292692 missense probably damaging 1.00
ergonomic UTSW 14 31300748 missense possibly damaging 0.91
faraday UTSW 14 31310882 missense probably null 0.05
K3955:Dnah1 UTSW 14 31266459 missense probably benign
PIT1430001:Dnah1 UTSW 14 31262580 missense probably damaging 1.00
PIT4382001:Dnah1 UTSW 14 31284455 missense probably damaging 1.00
R0043:Dnah1 UTSW 14 31274405 missense probably damaging 0.97
R0092:Dnah1 UTSW 14 31271609 missense probably benign 0.00
R0100:Dnah1 UTSW 14 31262152 critical splice donor site probably null
R0100:Dnah1 UTSW 14 31262152 critical splice donor site probably null
R0101:Dnah1 UTSW 14 31283899 missense probably damaging 1.00
R0119:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0136:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0144:Dnah1 UTSW 14 31267874 splice site probably benign
R0279:Dnah1 UTSW 14 31302375 missense possibly damaging 0.94
R0299:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0316:Dnah1 UTSW 14 31278151 missense probably benign 0.00
R0739:Dnah1 UTSW 14 31265915 nonsense probably null
R0789:Dnah1 UTSW 14 31304591 missense probably benign
R1102:Dnah1 UTSW 14 31296457 nonsense probably null
R1116:Dnah1 UTSW 14 31307867 missense probably benign 0.13
R1229:Dnah1 UTSW 14 31310851 missense probably benign 0.11
R1447:Dnah1 UTSW 14 31306898 missense probably benign 0.06
R1449:Dnah1 UTSW 14 31263951 missense probably damaging 1.00
R1462:Dnah1 UTSW 14 31268781 splice site probably benign
R1482:Dnah1 UTSW 14 31294874 missense probably damaging 1.00
R1500:Dnah1 UTSW 14 31316758 missense probably benign
R1512:Dnah1 UTSW 14 31293037 missense probably damaging 1.00
R1591:Dnah1 UTSW 14 31272332 missense probably benign 0.01
R1598:Dnah1 UTSW 14 31301262 missense probably benign 0.07
R1644:Dnah1 UTSW 14 31302292 splice site probably benign
R1672:Dnah1 UTSW 14 31276200 missense probably damaging 1.00
R1713:Dnah1 UTSW 14 31279182 missense probably damaging 1.00
R1769:Dnah1 UTSW 14 31310882 missense probably null 0.05
R1796:Dnah1 UTSW 14 31261093 missense probably benign 0.00
R1902:Dnah1 UTSW 14 31319759 missense probably damaging 0.99
R1903:Dnah1 UTSW 14 31319759 missense probably damaging 0.99
R1905:Dnah1 UTSW 14 31264630 missense probably benign 0.06
R1908:Dnah1 UTSW 14 31262558 missense probably damaging 1.00
R1972:Dnah1 UTSW 14 31265391 nonsense probably null
R1973:Dnah1 UTSW 14 31265391 nonsense probably null
R2004:Dnah1 UTSW 14 31301856 missense possibly damaging 0.79
R2051:Dnah1 UTSW 14 31279123 missense probably damaging 1.00
R2062:Dnah1 UTSW 14 31271129 missense probably damaging 1.00
R2188:Dnah1 UTSW 14 31279164 missense probably damaging 0.98
R2240:Dnah1 UTSW 14 31299974 missense probably benign 0.00
R2862:Dnah1 UTSW 14 31284762 missense probably benign 0.21
R2894:Dnah1 UTSW 14 31298761 missense possibly damaging 0.67
R3120:Dnah1 UTSW 14 31266822 nonsense probably null
R3410:Dnah1 UTSW 14 31269817 missense possibly damaging 0.55
R3411:Dnah1 UTSW 14 31269817 missense possibly damaging 0.55
R3435:Dnah1 UTSW 14 31316674 missense probably damaging 0.96
R3615:Dnah1 UTSW 14 31315148 missense possibly damaging 0.92
R3616:Dnah1 UTSW 14 31315148 missense possibly damaging 0.92
R3741:Dnah1 UTSW 14 31265467 splice site probably benign
R3805:Dnah1 UTSW 14 31294763 missense possibly damaging 0.67
R3894:Dnah1 UTSW 14 31307028 missense probably benign
R4007:Dnah1 UTSW 14 31303784 splice site probably benign
R4201:Dnah1 UTSW 14 31262270 missense probably benign 0.00
R4232:Dnah1 UTSW 14 31304916 missense probably benign
R4372:Dnah1 UTSW 14 31304922 missense probably damaging 1.00
R4391:Dnah1 UTSW 14 31294835 missense probably damaging 1.00
R4423:Dnah1 UTSW 14 31284761 missense probably benign 0.00
R4526:Dnah1 UTSW 14 31285998 missense probably benign 0.05
R4650:Dnah1 UTSW 14 31284887 splice site probably null
R4723:Dnah1 UTSW 14 31272942 missense probably damaging 1.00
R4748:Dnah1 UTSW 14 31319945 missense probably benign
R4783:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4784:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4785:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4843:Dnah1 UTSW 14 31264963 missense probably damaging 1.00
R4879:Dnah1 UTSW 14 31300748 missense possibly damaging 0.91
R4897:Dnah1 UTSW 14 31267539 missense probably damaging 1.00
R4911:Dnah1 UTSW 14 31295323 missense probably damaging 1.00
R4985:Dnah1 UTSW 14 31286898 missense probably null 1.00
R5070:Dnah1 UTSW 14 31282418 missense probably benign 0.05
R5128:Dnah1 UTSW 14 31296195 splice site probably null
R5409:Dnah1 UTSW 14 31263255 missense probably damaging 1.00
R5436:Dnah1 UTSW 14 31316747 missense probably benign
R5481:Dnah1 UTSW 14 31308871 missense possibly damaging 0.55
R5550:Dnah1 UTSW 14 31316708 missense probably benign 0.00
R5555:Dnah1 UTSW 14 31290819 missense probably damaging 0.99
R5566:Dnah1 UTSW 14 31274366 missense probably benign 0.35
R5623:Dnah1 UTSW 14 31286023 missense possibly damaging 0.62
R5701:Dnah1 UTSW 14 31274044 missense probably damaging 1.00
R5751:Dnah1 UTSW 14 31310906 missense probably benign 0.00
R5823:Dnah1 UTSW 14 31266418 missense possibly damaging 0.92
R6030:Dnah1 UTSW 14 31268027 missense probably damaging 1.00
R6030:Dnah1 UTSW 14 31268027 missense probably damaging 1.00
R6090:Dnah1 UTSW 14 31269425 missense possibly damaging 0.83
R6139:Dnah1 UTSW 14 31286027 missense probably benign 0.02
R6145:Dnah1 UTSW 14 31300970 missense probably benign 0.07
R6306:Dnah1 UTSW 14 31304587 missense probably damaging 0.97
R6376:Dnah1 UTSW 14 31275608 missense probably damaging 1.00
R6451:Dnah1 UTSW 14 31300808 missense probably benign 0.08
R6549:Dnah1 UTSW 14 31269383 missense probably damaging 1.00
R6748:Dnah1 UTSW 14 31299988 missense probably damaging 0.99
R6826:Dnah1 UTSW 14 31286290 missense probably benign 0.00
R6870:Dnah1 UTSW 14 31271061 nonsense probably null
R6932:Dnah1 UTSW 14 31287776 missense probably damaging 1.00
R6944:Dnah1 UTSW 14 31268904 missense probably damaging 1.00
R7033:Dnah1 UTSW 14 31264925 missense probably damaging 1.00
R7078:Dnah1 UTSW 14 31297110 missense probably damaging 1.00
R7133:Dnah1 UTSW 14 31286076 missense probably benign
R7136:Dnah1 UTSW 14 31298656 missense probably damaging 1.00
Z1088:Dnah1 UTSW 14 31304811 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CACAGCTCTGAATCCCTGTTGTACC -3'
(R):5'- AGCGATTTTAGCACCATAGTGACCC -3'

Sequencing Primer
(F):5'- TGCAAACTTTACCCTGGGC -3'
(R):5'- TTTAGCACCATAGTGACCCTATCAG -3'
Posted On2013-10-16