Incidental Mutation 'R0828:Tcp11l1'
ID78360
Institutional Source Beutler Lab
Gene Symbol Tcp11l1
Ensembl Gene ENSMUSG00000027175
Gene Namet-complex 11 like 1
Synonyms
MMRRC Submission 039008-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R0828 (G1)
Quality Score180
Status Validated
Chromosome2
Chromosomal Location104657288-104712169 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 104699836 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028597] [ENSMUST00000111118]
Predicted Effect probably benign
Transcript: ENSMUST00000028597
SMART Domains Protein: ENSMUSP00000028597
Gene: ENSMUSG00000027175

DomainStartEndE-ValueType
low complexity region 12 30 N/A INTRINSIC
Pfam:Tcp11 78 502 3.9e-105 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111118
SMART Domains Protein: ENSMUSP00000106747
Gene: ENSMUSG00000027175

DomainStartEndE-ValueType
low complexity region 12 30 N/A INTRINSIC
Pfam:Tcp11 77 505 5.2e-134 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126310
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137428
Meta Mutation Damage Score 0.0616 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik A G 16: 13,677,805 Y256C probably damaging Het
5730522E02Rik C T 11: 25,652,020 C70Y unknown Het
Abi3bp C T 16: 56,677,830 T929I probably damaging Het
Adap2 C A 11: 80,165,664 probably benign Het
Adgrg5 A G 8: 94,941,785 probably null Het
Afdn C A 17: 13,903,998 N1803K probably damaging Het
Alox12b T C 11: 69,166,306 L451P possibly damaging Het
Ankrd26 T C 6: 118,533,473 probably benign Het
Bcr A T 10: 75,157,207 probably benign Het
Cacna1c T C 6: 118,757,386 N300D probably benign Het
Camsap1 G T 2: 25,939,085 Q876K probably damaging Het
Cdh10 A G 15: 18,986,751 D356G possibly damaging Het
Cdipt T A 7: 126,976,920 Y16N probably damaging Het
Cebpz T C 17: 78,925,982 E772G probably benign Het
Cep350 A G 1: 155,953,246 I304T probably benign Het
Chpt1 C A 10: 88,476,415 G9V probably damaging Het
Col6a5 T A 9: 105,862,064 probably null Het
Dock7 G T 4: 99,015,745 P688T probably damaging Het
Ephb3 T A 16: 21,219,034 probably benign Het
Fcgr2b T C 1: 170,961,030 Y336C probably damaging Het
Flg2 A T 3: 93,203,332 H889L unknown Het
Gucy2c C T 6: 136,709,748 V806M probably damaging Het
Hmgxb3 T A 18: 61,171,354 I55F probably damaging Het
Igsf9b T A 9: 27,319,605 Y301* probably null Het
Il12rb2 C T 6: 67,356,707 R196H probably benign Het
Itgam T C 7: 128,116,505 probably null Het
Klhl25 T C 7: 75,866,195 V283A probably damaging Het
Klhl5 T C 5: 65,162,792 L423P probably damaging Het
Krt6a T C 15: 101,693,836 N138S probably damaging Het
Lrba A T 3: 86,608,370 probably null Het
Map4k5 T C 12: 69,805,326 T828A probably damaging Het
March8 T A 6: 116,405,678 M434K probably benign Het
Mink1 C T 11: 70,610,145 Q743* probably null Het
Mrgpra3 T C 7: 47,590,136 N14S probably benign Het
Mroh7 T C 4: 106,699,876 S808G probably damaging Het
Msi1 T C 5: 115,430,894 probably null Het
Nrap A G 19: 56,345,558 Y874H probably damaging Het
Nup205 T C 6: 35,194,566 F455L probably benign Het
Olfr31 G T 14: 14,328,800 V230L probably benign Het
Piwil2 A G 14: 70,376,017 V894A probably damaging Het
Polr1c A G 17: 46,245,064 S173P probably damaging Het
Prep C T 10: 45,155,525 A564V probably benign Het
Rab3gap1 T C 1: 127,938,185 probably benign Het
Rcc1 G C 4: 132,335,825 probably benign Het
Scn11a T A 9: 119,755,007 D1514V probably benign Het
Setdb1 G A 3: 95,338,860 P584S probably damaging Het
Slc12a7 A G 13: 73,788,652 I144V probably benign Het
Slc45a4 T C 15: 73,586,816 M295V probably benign Het
Slco1a1 T A 6: 141,921,839 D456V possibly damaging Het
Sspo G T 6: 48,498,734 C4928F probably damaging Het
St6galnac1 T A 11: 116,768,997 K163N probably benign Het
Tns1 T A 1: 73,919,666 I1715F probably damaging Het
Trpa1 C T 1: 14,875,884 V1008M probably damaging Het
Ttc28 A G 5: 111,223,446 E587G probably damaging Het
Ubr4 T C 4: 139,450,553 probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp8 G A 2: 126,742,114 probably benign Het
Zfc3h1 G T 10: 115,401,707 A464S possibly damaging Het
Zfp106 T C 2: 120,535,603 I108V probably benign Het
Other mutations in Tcp11l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01370:Tcp11l1 APN 2 104706486 missense probably benign
IGL01999:Tcp11l1 APN 2 104698569 missense possibly damaging 0.61
IGL02792:Tcp11l1 APN 2 104681820 missense probably benign 0.19
R0376:Tcp11l1 UTSW 2 104697505 splice site probably benign
R0683:Tcp11l1 UTSW 2 104681892 missense possibly damaging 0.90
R2091:Tcp11l1 UTSW 2 104684139 missense possibly damaging 0.77
R2095:Tcp11l1 UTSW 2 104681840 missense probably damaging 1.00
R3750:Tcp11l1 UTSW 2 104698542 missense probably damaging 1.00
R4456:Tcp11l1 UTSW 2 104684222 missense probably damaging 1.00
R4926:Tcp11l1 UTSW 2 104681785 missense probably benign 0.01
R5184:Tcp11l1 UTSW 2 104699944 missense probably damaging 1.00
R5461:Tcp11l1 UTSW 2 104688511 missense probably benign 0.00
R6979:Tcp11l1 UTSW 2 104706439 missense probably benign
V8831:Tcp11l1 UTSW 2 104685484 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTTCACAGACTCCAGAGCCTTTACTTG -3'
(R):5'- CTTCAGCAGTCTTAGTGGGAATCACG -3'

Sequencing Primer
(F):5'- CTTTACTTGTATCCTGAAGTACACG -3'
(R):5'- ATCTGGCTGCGACCTAAC -3'
Posted On2013-10-16