Incidental Mutation 'R0828:Ugcg'
ID78365
Institutional Source Beutler Lab
Gene Symbol Ugcg
Ensembl Gene ENSMUSG00000028381
Gene NameUDP-glucose ceramide glucosyltransferase
SynonymsEpcs21, Ugcgl, GlcT-1
MMRRC Submission 039008-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0828 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location59189257-59222833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 59207798 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 46 (P46S)
Ref Sequence ENSEMBL: ENSMUSP00000030074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030074]
Predicted Effect probably benign
Transcript: ENSMUST00000030074
AA Change: P46S

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030074
Gene: ENSMUSG00000028381
AA Change: P46S

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 51 278 1.3e-26 PFAM
Pfam:Glyco_transf_21 106 278 8.4e-61 PFAM
Pfam:Glyco_trans_2_3 139 368 9.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155153
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the first glycosylation step in the biosynthesis of glycosphingolipids, which are membrane components containing lipid and sugar moieties. The product of this reaction is glucosylceramide, which is the core structure of many glycosphingolipids. [provided by RefSeq, Dec 2014]
PHENOTYPE: At embryonic day 7.5, embryos homozygous for a null mutation exhibit decreased size, markedly reduced extraembryonic tissues and a large increase in cells undergoing apoptosis. Mutants die by embryonic day 8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik A G 16: 13,677,805 Y256C probably damaging Het
5730522E02Rik C T 11: 25,652,020 C70Y unknown Het
Abi3bp C T 16: 56,677,830 T929I probably damaging Het
Adap2 C A 11: 80,165,664 probably benign Het
Adgrg5 A G 8: 94,941,785 probably null Het
Afdn C A 17: 13,903,998 N1803K probably damaging Het
Alox12b T C 11: 69,166,306 L451P possibly damaging Het
Ankrd26 T C 6: 118,533,473 probably benign Het
Bcr A T 10: 75,157,207 probably benign Het
Cacna1c T C 6: 118,757,386 N300D probably benign Het
Camsap1 G T 2: 25,939,085 Q876K probably damaging Het
Cdh10 A G 15: 18,986,751 D356G possibly damaging Het
Cdipt T A 7: 126,976,920 Y16N probably damaging Het
Cebpz T C 17: 78,925,982 E772G probably benign Het
Cep350 A G 1: 155,953,246 I304T probably benign Het
Chpt1 C A 10: 88,476,415 G9V probably damaging Het
Col6a5 T A 9: 105,862,064 probably null Het
Dock7 G T 4: 99,015,745 P688T probably damaging Het
Ephb3 T A 16: 21,219,034 probably benign Het
Fcgr2b T C 1: 170,961,030 Y336C probably damaging Het
Flg2 A T 3: 93,203,332 H889L unknown Het
Gucy2c C T 6: 136,709,748 V806M probably damaging Het
Hmgxb3 T A 18: 61,171,354 I55F probably damaging Het
Igsf9b T A 9: 27,319,605 Y301* probably null Het
Il12rb2 C T 6: 67,356,707 R196H probably benign Het
Itgam T C 7: 128,116,505 probably null Het
Klhl25 T C 7: 75,866,195 V283A probably damaging Het
Klhl5 T C 5: 65,162,792 L423P probably damaging Het
Krt6a T C 15: 101,693,836 N138S probably damaging Het
Lrba A T 3: 86,608,370 probably null Het
Map4k5 T C 12: 69,805,326 T828A probably damaging Het
March8 T A 6: 116,405,678 M434K probably benign Het
Mink1 C T 11: 70,610,145 Q743* probably null Het
Mrgpra3 T C 7: 47,590,136 N14S probably benign Het
Mroh7 T C 4: 106,699,876 S808G probably damaging Het
Msi1 T C 5: 115,430,894 probably null Het
Nrap A G 19: 56,345,558 Y874H probably damaging Het
Nup205 T C 6: 35,194,566 F455L probably benign Het
Olfr31 G T 14: 14,328,800 V230L probably benign Het
Piwil2 A G 14: 70,376,017 V894A probably damaging Het
Polr1c A G 17: 46,245,064 S173P probably damaging Het
Prep C T 10: 45,155,525 A564V probably benign Het
Rab3gap1 T C 1: 127,938,185 probably benign Het
Rcc1 G C 4: 132,335,825 probably benign Het
Scn11a T A 9: 119,755,007 D1514V probably benign Het
Setdb1 G A 3: 95,338,860 P584S probably damaging Het
Slc12a7 A G 13: 73,788,652 I144V probably benign Het
Slc45a4 T C 15: 73,586,816 M295V probably benign Het
Slco1a1 T A 6: 141,921,839 D456V possibly damaging Het
Sspo G T 6: 48,498,734 C4928F probably damaging Het
St6galnac1 T A 11: 116,768,997 K163N probably benign Het
Tcp11l1 A T 2: 104,699,836 probably benign Het
Tns1 T A 1: 73,919,666 I1715F probably damaging Het
Trpa1 C T 1: 14,875,884 V1008M probably damaging Het
Ttc28 A G 5: 111,223,446 E587G probably damaging Het
Ubr4 T C 4: 139,450,553 probably benign Het
Usp8 G A 2: 126,742,114 probably benign Het
Zfc3h1 G T 10: 115,401,707 A464S possibly damaging Het
Zfp106 T C 2: 120,535,603 I108V probably benign Het
Other mutations in Ugcg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Ugcg APN 4 59213865 missense possibly damaging 0.94
IGL01768:Ugcg APN 4 59217216 critical splice donor site probably null
IGL02636:Ugcg APN 4 59207763 missense possibly damaging 0.73
IGL02672:Ugcg APN 4 59218587 splice site probably benign
IGL02798:Ugcg APN 4 59220346 missense probably damaging 1.00
R0013:Ugcg UTSW 4 59213931 missense possibly damaging 0.82
R0013:Ugcg UTSW 4 59213931 missense possibly damaging 0.82
R0068:Ugcg UTSW 4 59217130 missense probably benign 0.16
R0068:Ugcg UTSW 4 59217130 missense probably benign 0.16
R0119:Ugcg UTSW 4 59217036 missense possibly damaging 0.85
R0230:Ugcg UTSW 4 59189739 nonsense probably null
R0299:Ugcg UTSW 4 59217036 missense possibly damaging 0.85
R0384:Ugcg UTSW 4 59220387 missense possibly damaging 0.91
R0499:Ugcg UTSW 4 59217036 missense possibly damaging 0.85
R0645:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0688:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0726:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0802:Ugcg UTSW 4 59189685 missense probably benign 0.00
R0803:Ugcg UTSW 4 59189685 missense probably benign 0.00
R0811:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0812:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0831:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0944:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0945:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0947:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1104:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1209:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1210:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1252:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1253:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1255:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1488:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1490:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1548:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1698:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1771:Ugcg UTSW 4 59207775 missense probably benign 0.05
R1776:Ugcg UTSW 4 59207775 missense probably benign 0.05
R1781:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1794:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1840:Ugcg UTSW 4 59219517 missense probably damaging 1.00
R1942:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2228:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2229:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2237:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2239:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2314:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2337:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2338:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2340:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2422:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2426:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2433:Ugcg UTSW 4 59207876 missense possibly damaging 0.89
R2680:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3076:Ugcg UTSW 4 59213922 missense probably damaging 1.00
R3078:Ugcg UTSW 4 59213922 missense probably damaging 1.00
R3689:Ugcg UTSW 4 59211883 missense probably benign 0.16
R3732:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3732:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3733:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3766:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3767:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3768:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3769:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3771:Ugcg UTSW 4 59189690 missense probably benign
R3847:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3848:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3916:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3917:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3958:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3959:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4023:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4024:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4025:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4065:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4066:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4427:Ugcg UTSW 4 59219555 missense probably benign 0.02
R5842:Ugcg UTSW 4 59219545 missense possibly damaging 0.93
R6012:Ugcg UTSW 4 59220272 missense probably damaging 0.96
R6080:Ugcg UTSW 4 59218524 missense possibly damaging 0.70
R6762:Ugcg UTSW 4 59219530 missense possibly damaging 0.86
Y4336:Ugcg UTSW 4 59207798 missense probably benign 0.17
Y4337:Ugcg UTSW 4 59207798 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGGTTTCCTTGTCAGAAAGATGTCAGC -3'
(R):5'- TAAGCCCACGATGTAGCCCATCTC -3'

Sequencing Primer
(F):5'- cccccctcttcaaacaaaaac -3'
(R):5'- GTAGCCCATCTCTCATAGGGATAG -3'
Posted On2013-10-16