Incidental Mutation 'R0828:Zfc3h1'
ID78393
Institutional Source Beutler Lab
Gene Symbol Zfc3h1
Ensembl Gene ENSMUSG00000034163
Gene Namezinc finger, C3H1-type containing
SynonymsCcdc131, Psrc2
MMRRC Submission 039008-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.933) question?
Stock #R0828 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location115384959-115432772 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 115401707 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 464 (A464S)
Ref Sequence ENSEMBL: ENSMUSP00000044069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036044]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036044
AA Change: A464S

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000044069
Gene: ENSMUSG00000034163
AA Change: A464S

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 29 90 N/A INTRINSIC
low complexity region 120 132 N/A INTRINSIC
low complexity region 143 214 N/A INTRINSIC
coiled coil region 361 393 N/A INTRINSIC
low complexity region 399 432 N/A INTRINSIC
coiled coil region 436 491 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 564 583 N/A INTRINSIC
low complexity region 595 619 N/A INTRINSIC
low complexity region 623 636 N/A INTRINSIC
low complexity region 716 729 N/A INTRINSIC
low complexity region 752 763 N/A INTRINSIC
coiled coil region 826 889 N/A INTRINSIC
coiled coil region 968 1000 N/A INTRINSIC
low complexity region 1001 1015 N/A INTRINSIC
Pfam:zf-C3H1 1187 1208 1.3e-11 PFAM
HAT 1384 1416 1.11e0 SMART
HAT 1418 1449 4.35e2 SMART
Blast:HAT 1495 1538 2e-9 BLAST
HAT 1653 1685 3.31e1 SMART
HAT 1762 1797 7.03e1 SMART
HAT 1922 1954 1.29e-1 SMART
low complexity region 1975 1992 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218674
Meta Mutation Damage Score 0.146 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.8%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik A G 16: 13,677,805 Y256C probably damaging Het
5730522E02Rik C T 11: 25,652,020 C70Y unknown Het
Abi3bp C T 16: 56,677,830 T929I probably damaging Het
Adap2 C A 11: 80,165,664 probably benign Het
Adgrg5 A G 8: 94,941,785 probably null Het
Afdn C A 17: 13,903,998 N1803K probably damaging Het
Alox12b T C 11: 69,166,306 L451P possibly damaging Het
Ankrd26 T C 6: 118,533,473 probably benign Het
Bcr A T 10: 75,157,207 probably benign Het
Cacna1c T C 6: 118,757,386 N300D probably benign Het
Camsap1 G T 2: 25,939,085 Q876K probably damaging Het
Cdh10 A G 15: 18,986,751 D356G possibly damaging Het
Cdipt T A 7: 126,976,920 Y16N probably damaging Het
Cebpz T C 17: 78,925,982 E772G probably benign Het
Cep350 A G 1: 155,953,246 I304T probably benign Het
Chpt1 C A 10: 88,476,415 G9V probably damaging Het
Col6a5 T A 9: 105,862,064 probably null Het
Dock7 G T 4: 99,015,745 P688T probably damaging Het
Ephb3 T A 16: 21,219,034 probably benign Het
Fcgr2b T C 1: 170,961,030 Y336C probably damaging Het
Flg2 A T 3: 93,203,332 H889L unknown Het
Gucy2c C T 6: 136,709,748 V806M probably damaging Het
Hmgxb3 T A 18: 61,171,354 I55F probably damaging Het
Igsf9b T A 9: 27,319,605 Y301* probably null Het
Il12rb2 C T 6: 67,356,707 R196H probably benign Het
Itgam T C 7: 128,116,505 probably null Het
Klhl25 T C 7: 75,866,195 V283A probably damaging Het
Klhl5 T C 5: 65,162,792 L423P probably damaging Het
Krt6a T C 15: 101,693,836 N138S probably damaging Het
Lrba A T 3: 86,608,370 probably null Het
Map4k5 T C 12: 69,805,326 T828A probably damaging Het
March8 T A 6: 116,405,678 M434K probably benign Het
Mink1 C T 11: 70,610,145 Q743* probably null Het
Mrgpra3 T C 7: 47,590,136 N14S probably benign Het
Mroh7 T C 4: 106,699,876 S808G probably damaging Het
Msi1 T C 5: 115,430,894 probably null Het
Nrap A G 19: 56,345,558 Y874H probably damaging Het
Nup205 T C 6: 35,194,566 F455L probably benign Het
Olfr31 G T 14: 14,328,800 V230L probably benign Het
Piwil2 A G 14: 70,376,017 V894A probably damaging Het
Polr1c A G 17: 46,245,064 S173P probably damaging Het
Prep C T 10: 45,155,525 A564V probably benign Het
Rab3gap1 T C 1: 127,938,185 probably benign Het
Rcc1 G C 4: 132,335,825 probably benign Het
Scn11a T A 9: 119,755,007 D1514V probably benign Het
Setdb1 G A 3: 95,338,860 P584S probably damaging Het
Slc12a7 A G 13: 73,788,652 I144V probably benign Het
Slc45a4 T C 15: 73,586,816 M295V probably benign Het
Slco1a1 T A 6: 141,921,839 D456V possibly damaging Het
Sspo G T 6: 48,498,734 C4928F probably damaging Het
St6galnac1 T A 11: 116,768,997 K163N probably benign Het
Tcp11l1 A T 2: 104,699,836 probably benign Het
Tns1 T A 1: 73,919,666 I1715F probably damaging Het
Trpa1 C T 1: 14,875,884 V1008M probably damaging Het
Ttc28 A G 5: 111,223,446 E587G probably damaging Het
Ubr4 T C 4: 139,450,553 probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Usp8 G A 2: 126,742,114 probably benign Het
Zfp106 T C 2: 120,535,603 I108V probably benign Het
Other mutations in Zfc3h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00698:Zfc3h1 APN 10 115419832 missense possibly damaging 0.92
IGL00793:Zfc3h1 APN 10 115416874 missense probably benign 0.00
IGL01349:Zfc3h1 APN 10 115423448 missense probably damaging 1.00
IGL01431:Zfc3h1 APN 10 115423223 missense possibly damaging 0.49
IGL02273:Zfc3h1 APN 10 115427099 missense probably benign
IGL02382:Zfc3h1 APN 10 115416876 nonsense probably null
IGL02397:Zfc3h1 APN 10 115407985 missense probably damaging 1.00
IGL02657:Zfc3h1 APN 10 115411954 missense possibly damaging 0.48
IGL02826:Zfc3h1 APN 10 115400904 missense probably benign 0.42
gnatcatcher UTSW 10 115400742 missense probably benign 0.39
vireo UTSW 10 115419901 missense probably benign 0.01
warbler UTSW 10 115406483 missense probably damaging 1.00
PIT4260001:Zfc3h1 UTSW 10 115390889 missense probably damaging 0.99
PIT4354001:Zfc3h1 UTSW 10 115427039 nonsense probably null
R0062:Zfc3h1 UTSW 10 115416753 missense probably benign 0.00
R0062:Zfc3h1 UTSW 10 115416753 missense probably benign 0.00
R0067:Zfc3h1 UTSW 10 115423474 missense possibly damaging 0.88
R0067:Zfc3h1 UTSW 10 115423474 missense possibly damaging 0.88
R0104:Zfc3h1 UTSW 10 115415287 missense possibly damaging 0.66
R0178:Zfc3h1 UTSW 10 115406725 splice site probably benign
R0355:Zfc3h1 UTSW 10 115409113 missense possibly damaging 0.80
R0619:Zfc3h1 UTSW 10 115420810 missense possibly damaging 0.92
R0731:Zfc3h1 UTSW 10 115410632 missense probably benign 0.00
R0866:Zfc3h1 UTSW 10 115427716 missense probably benign 0.00
R1196:Zfc3h1 UTSW 10 115411961 missense probably damaging 0.99
R1455:Zfc3h1 UTSW 10 115412108 missense probably benign 0.11
R1515:Zfc3h1 UTSW 10 115416742 missense probably benign 0.29
R1617:Zfc3h1 UTSW 10 115390922 missense probably benign 0.01
R1640:Zfc3h1 UTSW 10 115406901 splice site probably null
R1959:Zfc3h1 UTSW 10 115423253 missense probably benign 0.34
R2039:Zfc3h1 UTSW 10 115406483 missense probably damaging 1.00
R3430:Zfc3h1 UTSW 10 115410523 splice site probably benign
R3691:Zfc3h1 UTSW 10 115420690 missense probably benign
R3909:Zfc3h1 UTSW 10 115419901 missense probably benign 0.01
R4235:Zfc3h1 UTSW 10 115418799 missense probably benign 0.32
R4684:Zfc3h1 UTSW 10 115423385 missense probably benign 0.03
R4816:Zfc3h1 UTSW 10 115415694 missense probably benign 0.16
R4881:Zfc3h1 UTSW 10 115400742 missense probably benign 0.39
R4883:Zfc3h1 UTSW 10 115410642 missense probably damaging 1.00
R5038:Zfc3h1 UTSW 10 115404211 missense probably benign 0.16
R5068:Zfc3h1 UTSW 10 115418783 nonsense probably null
R5069:Zfc3h1 UTSW 10 115418783 nonsense probably null
R5070:Zfc3h1 UTSW 10 115418783 nonsense probably null
R5155:Zfc3h1 UTSW 10 115412121 missense possibly damaging 0.64
R5190:Zfc3h1 UTSW 10 115418692 missense probably damaging 1.00
R5499:Zfc3h1 UTSW 10 115410693 missense probably damaging 1.00
R5932:Zfc3h1 UTSW 10 115400910 missense probably benign 0.44
R5935:Zfc3h1 UTSW 10 115431357 intron probably benign
R6165:Zfc3h1 UTSW 10 115420669 missense probably benign 0.30
R6182:Zfc3h1 UTSW 10 115390859 missense probably benign 0.00
R6262:Zfc3h1 UTSW 10 115413976 missense probably damaging 1.00
R6382:Zfc3h1 UTSW 10 115407908 missense probably benign 0.06
R6392:Zfc3h1 UTSW 10 115401748 missense probably damaging 1.00
R6539:Zfc3h1 UTSW 10 115412002 missense probably benign 0.26
R6723:Zfc3h1 UTSW 10 115420733 missense probably benign 0.34
R7339:Zfc3h1 UTSW 10 115403300 missense probably damaging 1.00
R7381:Zfc3h1 UTSW 10 115424630 missense probably benign
R7404:Zfc3h1 UTSW 10 115415248 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTATCAGTAGGACTCAGGGAGGACCG -3'
(R):5'- TGTTCTGACCCTCAGAAAACGAATGC -3'

Sequencing Primer
(F):5'- CCGTGGTAGTTAGCGATATAAGAAC -3'
(R):5'- ATGCATGCATGCACGAGT -3'
Posted On2013-10-16