Incidental Mutation 'R0812:Klhl22'
ID78495
Institutional Source Beutler Lab
Gene Symbol Klhl22
Ensembl Gene ENSMUSG00000022750
Gene Namekelch-like 22
SynonymsKelchl, 2610318I18Rik
MMRRC Submission 038992-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R0812 (G1)
Quality Score167
Status Validated
Chromosome16
Chromosomal Location17759618-17793382 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 17792589 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 568 (M568K)
Ref Sequence ENSEMBL: ENSMUSP00000114115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012161] [ENSMUST00000117192] [ENSMUST00000120488] [ENSMUST00000165790] [ENSMUST00000232577]
Predicted Effect probably benign
Transcript: ENSMUST00000012161
SMART Domains Protein: ENSMUSP00000012161
Gene: ENSMUSG00000012017

DomainStartEndE-ValueType
signal peptide 1 35 N/A INTRINSIC
EGF 71 102 4.56e0 SMART
EGF 113 145 2.43e1 SMART
EGF 147 174 2.03e1 SMART
EGF_like 207 233 1.68e0 SMART
EGF 235 262 1.73e1 SMART
EGF_like 309 352 2.86e1 SMART
EGF_like 323 364 4.97e0 SMART
EGF_like 367 407 8.13e-1 SMART
low complexity region 437 459 N/A INTRINSIC
low complexity region 530 541 N/A INTRINSIC
low complexity region 565 577 N/A INTRINSIC
low complexity region 597 606 N/A INTRINSIC
low complexity region 616 632 N/A INTRINSIC
low complexity region 636 656 N/A INTRINSIC
low complexity region 665 685 N/A INTRINSIC
low complexity region 702 726 N/A INTRINSIC
low complexity region 781 802 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117192
AA Change: M568K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000114115
Gene: ENSMUSG00000022750
AA Change: M568K

DomainStartEndE-ValueType
BTB 50 147 3.58e-26 SMART
BACK 152 258 2.14e-19 SMART
Kelch 299 349 8.12e0 SMART
Kelch 350 399 8.09e-4 SMART
Kelch 400 446 1.69e-6 SMART
Kelch 447 493 1.53e-4 SMART
Kelch 494 544 7.59e-2 SMART
Kelch 545 593 1.04e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000120488
AA Change: M568K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112412
Gene: ENSMUSG00000022750
AA Change: M568K

DomainStartEndE-ValueType
BTB 50 147 3.58e-26 SMART
BACK 152 258 2.14e-19 SMART
Kelch 299 349 8.12e0 SMART
Kelch 350 399 8.09e-4 SMART
Kelch 400 446 1.69e-6 SMART
Kelch 447 493 1.53e-4 SMART
Kelch 494 544 7.59e-2 SMART
Kelch 545 593 1.04e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165790
AA Change: M568K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127227
Gene: ENSMUSG00000022750
AA Change: M568K

DomainStartEndE-ValueType
BTB 50 147 3.58e-26 SMART
BACK 152 258 2.14e-19 SMART
Kelch 299 349 8.12e0 SMART
Kelch 350 399 8.09e-4 SMART
Kelch 400 446 1.69e-6 SMART
Kelch 447 493 1.53e-4 SMART
Kelch 494 544 7.59e-2 SMART
Kelch 545 593 1.04e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231329
Predicted Effect probably benign
Transcript: ENSMUST00000232577
Meta Mutation Damage Score 0.1344 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 96.8%
  • 20x: 91.7%
Validation Efficiency 96% (52/54)
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,713,414 F858S probably damaging Het
Abcb1a T C 5: 8,713,229 S586P probably damaging Het
Abcc3 G A 11: 94,375,202 probably benign Het
Ap5z1 G A 5: 142,475,791 R583H probably benign Het
Arrb1 G T 7: 99,598,501 V346L probably benign Het
Atrnl1 T A 19: 57,673,141 F518I probably benign Het
Bank1 T A 3: 136,093,366 I405F probably damaging Het
Cacna1c A G 6: 118,630,263 C1227R probably benign Het
Cacna1h A G 17: 25,388,628 L905P probably damaging Het
Cc2d1a A G 8: 84,133,836 Y826H probably benign Het
Cenpo A G 12: 4,216,643 V155A probably benign Het
Cnmd A G 14: 79,661,423 F63S probably damaging Het
Cnn3 G A 3: 121,454,951 G72D probably damaging Het
Cox10 A G 11: 64,071,713 S101P probably benign Het
Ctdsp1 T C 1: 74,394,647 V129A probably damaging Het
Cyp2d34 A T 15: 82,618,606 S140T probably benign Het
Dennd5a G A 7: 109,933,613 H317Y possibly damaging Het
Eef2 C CN 10: 81,178,769 probably null Het
Enox1 T A 14: 77,582,436 D210E probably damaging Het
Fam171a1 A G 2: 3,197,427 N190S probably damaging Het
Fat2 T A 11: 55,253,633 K4138N possibly damaging Het
Fat4 A T 3: 38,957,474 D2241V probably damaging Het
Fbn1 C T 2: 125,403,170 V266I possibly damaging Het
Foxf2 T A 13: 31,627,205 Y376N probably damaging Het
Fras1 T A 5: 96,752,998 S3025R probably benign Het
Gba T C 3: 89,204,000 I24T probably benign Het
Gdpd5 A G 7: 99,438,333 D68G probably damaging Het
Grid1 G A 14: 34,822,619 S49N probably benign Het
Grtp1 T C 8: 13,179,639 T250A possibly damaging Het
Gucy1b1 T C 3: 82,037,988 N448D probably benign Het
H2-Ob A G 17: 34,244,126 probably benign Het
Hcn4 A G 9: 58,823,512 M1V probably null Het
Hmcn2 G A 2: 31,420,371 A3326T probably damaging Het
Impg2 TACCACCACCACCACCACCACCACCA TACCACCACCACCACCACCACCA 16: 56,257,939 probably benign Het
Ippk C A 13: 49,443,471 Q254K probably damaging Het
Itga2 A T 13: 114,870,614 L393I possibly damaging Het
Kcna10 A T 3: 107,195,259 E402V possibly damaging Het
Kcnab1 G A 3: 65,297,720 D119N probably damaging Het
Kcnip4 T A 5: 48,409,860 T122S probably benign Het
Kcnma1 G A 14: 23,300,018 P1151L probably damaging Het
Krt6a C T 15: 101,692,748 V257M probably damaging Het
Ksr2 A C 5: 117,555,225 H246P probably damaging Het
Lca5 T C 9: 83,399,753 D326G possibly damaging Het
Lcp1 A G 14: 75,214,488 E393G probably benign Het
Leo1 G A 9: 75,445,549 E125K probably benign Het
Lipt1 T A 1: 37,875,301 V146E probably damaging Het
Mael A T 1: 166,235,399 probably null Het
Mga C T 2: 119,947,961 L1996F probably damaging Het
Mllt6 A G 11: 97,678,561 N913S probably damaging Het
Mphosph9 A C 5: 124,298,759 D507E probably damaging Het
Mvp G A 7: 126,987,556 A801V probably benign Het
Ndrg2 A G 14: 51,908,662 probably benign Het
Neb T C 2: 52,292,695 D1053G possibly damaging Het
Nubp1 C A 16: 10,413,721 L79I probably benign Het
Olfr397 G A 11: 73,965,420 E271K probably benign Het
Olfr924 G A 9: 38,848,509 V132I probably benign Het
Olfr97 A C 17: 37,232,332 L13V probably benign Het
Pnpla8 G A 12: 44,283,405 V29M probably benign Het
Psmb2 T A 4: 126,707,557 I151N possibly damaging Het
Ptgs2 C T 1: 150,101,354 T104I probably benign Het
Ptpro A G 6: 137,368,079 T28A probably benign Het
Raf1 A G 6: 115,626,710 probably null Het
Ranbp2 T C 10: 58,465,529 M668T probably benign Het
Rbm48 A T 5: 3,591,760 probably null Het
Rhag A T 17: 40,831,578 T225S possibly damaging Het
Rhof A C 5: 123,131,887 L69R probably damaging Het
Slc24a5 T C 2: 125,068,804 S52P probably damaging Het
Slc8a2 T C 7: 16,141,114 V429A probably damaging Het
Slfn10-ps G A 11: 83,035,562 noncoding transcript Het
Spam1 G A 6: 24,796,887 R279H probably damaging Het
Srfbp1 A G 18: 52,487,516 D102G probably damaging Het
Srrm3 A C 5: 135,873,282 probably benign Het
Tk1 T C 11: 117,822,107 E98G probably damaging Het
Trim13 G A 14: 61,605,700 V389I probably benign Het
Ttc28 A T 5: 111,235,500 Y1289F probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ugt1a10 T A 1: 88,056,182 V234D probably benign Het
Vmn2r18 C A 5: 151,572,930 probably benign Het
Vmn2r75 C T 7: 86,165,367 G306E probably benign Het
Vmn2r86 C T 10: 130,453,628 V133I probably benign Het
Vps13c C A 9: 67,934,476 Q1927K probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp219 T A 14: 52,006,938 T550S probably benign Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Zfp507 G A 7: 35,802,623 probably benign Het
Zfp97 T A 17: 17,145,290 F350L possibly damaging Het
Other mutations in Klhl22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01958:Klhl22 APN 16 17776462 missense probably benign 0.03
IGL01973:Klhl22 APN 16 17792711 missense probably benign 0.00
IGL02115:Klhl22 APN 16 17776595 missense probably damaging 0.99
IGL02383:Klhl22 APN 16 17776898 missense possibly damaging 0.60
IGL03381:Klhl22 APN 16 17792727 missense possibly damaging 0.71
R0562:Klhl22 UTSW 16 17792624 missense probably benign
R0811:Klhl22 UTSW 16 17792589 missense probably benign 0.01
R1661:Klhl22 UTSW 16 17776488 missense probably benign 0.01
R1665:Klhl22 UTSW 16 17776488 missense probably benign 0.01
R1732:Klhl22 UTSW 16 17777024 missense probably damaging 1.00
R1902:Klhl22 UTSW 16 17771787 missense probably damaging 1.00
R2042:Klhl22 UTSW 16 17792420 unclassified probably benign
R2083:Klhl22 UTSW 16 17776525 missense probably benign
R4368:Klhl22 UTSW 16 17789273 missense possibly damaging 0.94
R4860:Klhl22 UTSW 16 17777016 synonymous silent
R6413:Klhl22 UTSW 16 17789317 missense probably benign 0.01
R7031:Klhl22 UTSW 16 17777026 missense probably damaging 1.00
R7095:Klhl22 UTSW 16 17792750 missense probably damaging 0.98
R7378:Klhl22 UTSW 16 17776805 missense probably damaging 1.00
R7565:Klhl22 UTSW 16 17789284 missense probably damaging 1.00
Z1088:Klhl22 UTSW 16 17776543 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- CCAGCCTTTCAAAGGGAGAGAAGC -3'
(R):5'- TCAGAAGCAAAGTCTGCATCTGCC -3'

Sequencing Primer
(F):5'- CAGAAGCTGCCTGGATTGAC -3'
(R):5'- TGCATCTGCCTGGCTACG -3'
Posted On2013-10-16