Incidental Mutation 'R0811:Olfr397'
ID78527
Institutional Source Beutler Lab
Gene Symbol Olfr397
Ensembl Gene ENSMUSG00000057050
Gene Nameolfactory receptor 397
SynonymsGA_x6K02T2P1NL-4121434-4122381, MOR135-28
MMRRC Submission 038991-MU
Accession Numbers

Genbank: NM_146346; MGI: 3030231

Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R0811 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73960817-73967812 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 73965420 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 271 (E271K)
Ref Sequence ENSEMBL: ENSMUSP00000150172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108465] [ENSMUST00000121280] [ENSMUST00000213134] [ENSMUST00000216291]
Predicted Effect probably benign
Transcript: ENSMUST00000108465
AA Change: E271K

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000104105
Gene: ENSMUSG00000062128
AA Change: E271K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 7.9e-60 PFAM
Pfam:7TM_GPCR_Srsx 35 305 7.8e-8 PFAM
Pfam:7tm_1 41 290 1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121280
AA Change: E271K

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000113870
Gene: ENSMUSG00000057050
AA Change: E271K

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 305 1.3e-6 PFAM
Pfam:7tm_1 41 290 4.3e-35 PFAM
Pfam:7tm_4 139 283 1.2e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213134
AA Change: E271K

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215020
Predicted Effect probably benign
Transcript: ENSMUST00000216291
AA Change: E271K

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.114 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.3%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik A G 2: 130,713,414 F858S probably damaging Het
Abcb1a T C 5: 8,713,229 S586P probably damaging Het
Ap5z1 G A 5: 142,475,791 R583H probably benign Het
Arhgap28 TCAGCAGCAGCAGCAGCAGCAG TCAGCAGCAGCAGCAGCAG 17: 67,901,299 probably benign Het
Arrb1 G T 7: 99,598,501 V346L probably benign Het
Atrnl1 T A 19: 57,673,141 F518I probably benign Het
Bank1 T A 3: 136,093,366 I405F probably damaging Het
Cacna1h A G 17: 25,388,628 L905P probably damaging Het
Cc2d1a A G 8: 84,133,836 Y826H probably benign Het
Cenpo A G 12: 4,216,643 V155A probably benign Het
Cnmd A G 14: 79,661,423 F63S probably damaging Het
Cnn3 G A 3: 121,454,951 G72D probably damaging Het
Cox10 A G 11: 64,071,713 S101P probably benign Het
Ctdsp1 T C 1: 74,394,647 V129A probably damaging Het
Cyp2d34 A T 15: 82,618,606 S140T probably benign Het
Dennd5a G A 7: 109,933,613 H317Y possibly damaging Het
Eef2 C CN 10: 81,178,769 probably null Het
Enox1 T A 14: 77,582,436 D210E probably damaging Het
Fam171a1 A G 2: 3,197,427 N190S probably damaging Het
Fat2 T A 11: 55,253,633 K4138N possibly damaging Het
Fat4 A T 3: 38,957,474 D2241V probably damaging Het
Fbn1 C T 2: 125,403,170 V266I possibly damaging Het
Fras1 T A 5: 96,752,998 S3025R probably benign Het
Gba T C 3: 89,204,000 I24T probably benign Het
Gdpd5 A G 7: 99,438,333 D68G probably damaging Het
Grid1 G A 14: 34,822,619 S49N probably benign Het
Grtp1 T C 8: 13,179,639 T250A possibly damaging Het
Gucy1b1 T C 3: 82,037,988 N448D probably benign Het
Hmcn2 G A 2: 31,420,371 A3326T probably damaging Het
Ippk C A 13: 49,443,471 Q254K probably damaging Het
Itga2 A T 13: 114,870,614 L393I possibly damaging Het
Kcna10 A T 3: 107,195,259 E402V possibly damaging Het
Kcnab1 G A 3: 65,297,720 D119N probably damaging Het
Kcnip4 T A 5: 48,409,860 T122S probably benign Het
Kcnma1 G A 14: 23,300,018 P1151L probably damaging Het
Klhl22 T A 16: 17,792,589 M568K probably benign Het
Krt6a C T 15: 101,692,748 V257M probably damaging Het
Ksr2 A C 5: 117,555,225 H246P probably damaging Het
Lca5 T C 9: 83,399,753 D326G possibly damaging Het
Lcp1 A G 14: 75,214,488 E393G probably benign Het
Leo1 G A 9: 75,445,549 E125K probably benign Het
Lipt1 T A 1: 37,875,301 V146E probably damaging Het
Mael A T 1: 166,235,399 probably null Het
Mga C T 2: 119,947,961 L1996F probably damaging Het
Mllt6 A G 11: 97,678,561 N913S probably damaging Het
Mphosph9 A C 5: 124,298,759 D507E probably damaging Het
Mvp G A 7: 126,987,556 A801V probably benign Het
Neb T C 2: 52,292,695 D1053G possibly damaging Het
Nubp1 C A 16: 10,413,721 L79I probably benign Het
Olfr924 G A 9: 38,848,509 V132I probably benign Het
Olfr97 A C 17: 37,232,332 L13V probably benign Het
Pithd1 A G 4: 135,977,134 probably benign Het
Pnpla8 G A 12: 44,283,405 V29M probably benign Het
Psmb2 T A 4: 126,707,557 I151N possibly damaging Het
Ptgs2 C T 1: 150,101,354 T104I probably benign Het
Ptpro A G 6: 137,368,079 T28A probably benign Het
Raf1 A G 6: 115,626,710 probably null Het
Ranbp2 T C 10: 58,465,529 M668T probably benign Het
Rbm48 A T 5: 3,591,760 probably null Het
Rhag A T 17: 40,831,578 T225S possibly damaging Het
Rhof A C 5: 123,131,887 L69R probably damaging Het
Slc22a1 T C 17: 12,666,618 probably benign Het
Slc24a5 T C 2: 125,068,804 S52P probably damaging Het
Slc8a2 T C 7: 16,141,114 V429A probably damaging Het
Spam1 G A 6: 24,796,887 R279H probably damaging Het
Spata16 T A 3: 26,913,338 probably benign Het
Srfbp1 A G 18: 52,487,516 D102G probably damaging Het
Srrm3 A C 5: 135,873,282 probably benign Het
Tbl1xr1 T A 3: 22,200,587 probably benign Het
Tk1 T C 11: 117,822,107 E98G probably damaging Het
Trim13 G A 14: 61,605,700 V389I probably benign Het
Ttc28 A T 5: 111,235,500 Y1289F probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ugt1a10 T A 1: 88,056,182 V234D probably benign Het
Vmn2r75 C T 7: 86,165,367 G306E probably benign Het
Vmn2r86 C T 10: 130,453,628 V133I probably benign Het
Vps13c C A 9: 67,934,476 Q1927K probably benign Het
Zbtb14 C A 17: 69,388,502 F398L probably damaging Het
Zfp219 T A 14: 52,006,938 T550S probably benign Het
Zfp329 T A 7: 12,811,468 N43I probably benign Het
Other mutations in Olfr397
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01797:Olfr397 APN 11 73964818 missense probably damaging 1.00
IGL01839:Olfr397 APN 11 73964611 start codon destroyed probably null 1.00
IGL02247:Olfr397 APN 11 73964862 missense probably benign 0.05
IGL02876:Olfr397 APN 11 73964713 missense possibly damaging 0.95
IGL03051:Olfr397 APN 11 73965034 missense probably benign 0.04
IGL03123:Olfr397 APN 11 73964986 missense probably damaging 1.00
IGL03401:Olfr397 APN 11 73965562 utr 3 prime probably benign
3-1:Olfr397 UTSW 11 73964977 missense possibly damaging 0.84
R0496:Olfr397 UTSW 11 73964880 missense probably benign 0.42
R0812:Olfr397 UTSW 11 73965420 missense probably benign 0.02
R1503:Olfr397 UTSW 11 73964568 utr 5 prime probably null
R2067:Olfr397 UTSW 11 73964914 missense probably damaging 1.00
R2111:Olfr397 UTSW 11 73964914 missense probably damaging 1.00
R4912:Olfr397 UTSW 11 73965340 missense probably damaging 1.00
R5240:Olfr397 UTSW 11 73964806 missense probably damaging 1.00
R5656:Olfr397 UTSW 11 73964710 missense probably damaging 0.99
R5801:Olfr397 UTSW 11 73964946 missense probably benign 0.39
R6329:Olfr397 UTSW 11 73964742 missense possibly damaging 0.73
R6720:Olfr397 UTSW 11 73965465 missense probably damaging 1.00
R7149:Olfr397 UTSW 11 73965431 missense probably benign 0.01
R7283:Olfr397 UTSW 11 73964808 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTCTTCTGAAGTTAGCCTGCTC -3'
(R):5'- AGTTGAAGAAAGCCCCTGCATACC -3'

Sequencing Primer
(F):5'- GAAGTTAGCCTGCTCTGACATTC -3'
(R):5'- CTGCATACCATTTGAAATTGGGC -3'
Posted On2013-10-16