Incidental Mutation 'R0814:4921517D22Rik'
List |< first << previous [record 12 of 1259] next >> last >|
ID78548
Institutional Source Beutler Lab
Gene Symbol 4921517D22Rik
Ensembl Gene ENSMUSG00000049902
Gene NameRIKEN cDNA 4921517D22 gene
Synonyms
MMRRC Submission 038994-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R0814 (G1)
Quality Score217
Status Not validated
Chromosome13
Chromosomal Location59687402-59694108 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GCC to GC at 59691598 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153380 (fasta)
Gene Model
Predicted Effect probably null
Transcript: ENSMUST00000061597
Predicted Effect probably null
Transcript: ENSMUST00000225373
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225788
Meta Mutation Damage Score 0.6464 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.4%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 2 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahctf1 C T 1: 179,762,908 G1267R probably benign Het
Neu4 AG A 1: 94,022,876 probably null Het
Other mutations in 4921517D22Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:4921517D22Rik APN 13 59689476 missense probably benign 0.00
IGL01516:4921517D22Rik APN 13 59690734 missense probably benign 0.00
R0395:4921517D22Rik UTSW 13 59689656 missense possibly damaging 0.94
R0579:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0664:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0757:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0758:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0777:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0779:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0870:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0872:4921517D22Rik UTSW 13 59691598 frame shift probably null
R0873:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1062:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1064:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1149:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1149:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1151:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1152:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1207:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1207:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1285:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1339:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1358:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1359:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1360:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1361:4921517D22Rik UTSW 13 59691598 frame shift probably null
R1679:4921517D22Rik UTSW 13 59691598 frame shift probably null
R4703:4921517D22Rik UTSW 13 59689528 missense possibly damaging 0.94
R4785:4921517D22Rik UTSW 13 59691592 missense probably benign
R4823:4921517D22Rik UTSW 13 59690904 missense probably damaging 0.99
R5054:4921517D22Rik UTSW 13 59689501 missense probably damaging 0.97
R6144:4921517D22Rik UTSW 13 59689533 missense probably damaging 0.99
R6977:4921517D22Rik UTSW 13 59691580 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- ACTGAAATGAAACTCCGGTGCCC -3'
(R):5'- TCACCAATGAAATGGTCAGAGCTGC -3'

Sequencing Primer
(F):5'- TCGCCTGCATGTGGTATCAT -3'
(R):5'- GCTACTTGAAACATGATTGACTCGAC -3'
Posted On2013-10-16