Incidental Mutation 'R0815:Lrrc8c'
ID78564
Institutional Source Beutler Lab
Gene Symbol Lrrc8c
Ensembl Gene ENSMUSG00000054720
Gene Nameleucine rich repeat containing 8 family, member C
SynonymsE430036I04Rik
MMRRC Submission 038995-MU
Accession Numbers

NCBI RefSeq: NM_133897.2; MGI:2140839

Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R0815 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location105519388-105613018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105608534 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 725 (L725P)
Ref Sequence ENSEMBL: ENSMUSP00000066015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067924] [ENSMUST00000153754]
Predicted Effect probably damaging
Transcript: ENSMUST00000067924
AA Change: L725P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066015
Gene: ENSMUSG00000054720
AA Change: L725P

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 338 5.7e-152 PFAM
low complexity region 398 407 N/A INTRINSIC
LRR 588 611 3.97e0 SMART
LRR 613 635 1.81e2 SMART
LRR 636 658 2.2e1 SMART
LRR_TYP 659 682 1.45e-2 SMART
LRR 684 703 3.56e2 SMART
LRR 705 728 2.92e1 SMART
LRR 751 774 1.09e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153754
SMART Domains Protein: ENSMUSP00000114899
Gene: ENSMUSG00000054720

DomainStartEndE-ValueType
Pfam:DUF3733 1 65 4.8e-35 PFAM
low complexity region 78 93 N/A INTRINSIC
Pfam:DUF3733 99 158 1.7e-26 PFAM
Meta Mutation Damage Score 0.338 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.5%
  • 20x: 91.3%
Validation Efficiency 97% (58/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction in body weight, white adipose tissue weight, and insulin resistance on a high-fat diet, indicating protection from diet-induced obesity and insulin resistance. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,351,087 I88L possibly damaging Het
Abcb5 A G 12: 118,901,449 probably benign Het
Abcf2 A T 5: 24,567,270 Y487N probably damaging Het
Adcy4 T C 14: 55,783,599 Y27C probably damaging Het
Atp2a2 T C 5: 122,471,236 I188V probably benign Het
Cacna1s A T 1: 136,112,957 I1231F possibly damaging Het
Capn7 T A 14: 31,369,757 C704S possibly damaging Het
Celsr2 G T 3: 108,401,301 T1770K possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cul9 T C 17: 46,537,822 probably null Het
Dpp10 A G 1: 123,432,929 probably null Het
Dscaml1 A G 9: 45,745,074 I1571V probably benign Het
Eif3j2 T A 18: 43,476,971 Y259F probably benign Het
Erc2 A C 14: 28,025,148 N345T probably benign Het
Fbxo21 T C 5: 117,995,508 probably benign Het
Frmd8 A T 19: 5,865,056 probably benign Het
Gfm1 T C 3: 67,474,595 S705P probably damaging Het
Gucy1b2 T C 14: 62,419,062 D282G probably benign Het
H2-Ab1 T C 17: 34,267,354 I129T probably damaging Het
H2-M10.3 T A 17: 36,366,690 Y232F probably damaging Het
Lipm A T 19: 34,118,761 T326S probably benign Het
Map3k19 A G 1: 127,834,638 probably benign Het
Med31 T A 11: 72,213,831 N50I probably damaging Het
Mgea5 C T 19: 45,782,986 A49T probably benign Het
Myo15b T G 11: 115,866,336 probably benign Het
Nemp1 T C 10: 127,693,024 L199S probably damaging Het
Nod2 G A 8: 88,672,662 probably benign Het
Olfr1444 A G 19: 12,862,644 I290V probably benign Het
Olfr319 A G 11: 58,702,609 R303G possibly damaging Het
Parva G A 7: 112,567,864 V215M probably damaging Het
Phf1 T C 17: 26,937,140 probably benign Het
Ppp1r12c G T 7: 4,486,366 Q240K probably damaging Het
Ralgapa1 A T 12: 55,762,681 Y436* probably null Het
Ralgapa1 C A 12: 55,782,777 probably benign Het
Rbm11 C T 16: 75,596,637 R74C probably damaging Het
Robo3 A G 9: 37,422,183 V744A probably damaging Het
Rsbn1 T G 3: 103,954,153 S522A probably damaging Het
Scel T A 14: 103,586,480 S381R possibly damaging Het
Sec31b G A 19: 44,518,173 Q909* probably null Het
Slc38a11 T A 2: 65,353,780 I176L possibly damaging Het
Slc39a4 C T 15: 76,612,639 D574N probably damaging Het
Slc44a1 T G 4: 53,536,421 V199G possibly damaging Het
Sltm A G 9: 70,561,908 T150A probably benign Het
Son C A 16: 91,655,484 A373D probably damaging Het
Sp140 C T 1: 85,620,051 probably benign Het
Speg A G 1: 75,415,392 Y1606C probably damaging Het
Srgap1 A T 10: 121,785,474 V1061D probably damaging Het
Stat5a A G 11: 100,875,082 probably null Het
Supt4a T A 11: 87,737,583 probably benign Het
Teddm1b A G 1: 153,874,892 K149R possibly damaging Het
Thnsl2 A T 6: 71,134,224 L220* probably null Het
Tinf2 G A 14: 55,680,109 P308S probably benign Het
Tmem131l A G 3: 83,940,572 S329P probably benign Het
Tnf T C 17: 35,201,144 probably benign Het
Upp2 A G 2: 58,771,556 T144A probably benign Het
Vmn2r94 T G 17: 18,257,711 Q146P probably damaging Het
Zfhx4 T A 3: 5,245,315 S919R possibly damaging Het
Other mutations in Lrrc8c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Lrrc8c APN 5 105607210 missense probably damaging 0.99
IGL00736:Lrrc8c APN 5 105607114 missense probably damaging 1.00
IGL00822:Lrrc8c APN 5 105608308 missense probably benign 0.04
IGL02009:Lrrc8c APN 5 105607391 missense probably damaging 1.00
IGL02156:Lrrc8c APN 5 105607493 missense probably damaging 1.00
IGL02266:Lrrc8c APN 5 105608248 missense probably benign 0.30
IGL02268:Lrrc8c APN 5 105607898 missense probably damaging 1.00
IGL02487:Lrrc8c APN 5 105606591 missense probably benign
IGL02536:Lrrc8c APN 5 105607172 missense probably benign 0.00
IGL02672:Lrrc8c APN 5 105607358 missense possibly damaging 0.85
IGL02860:Lrrc8c APN 5 105579615 splice site probably benign
IGL03395:Lrrc8c APN 5 105606629 missense probably benign
P0014:Lrrc8c UTSW 5 105607244 missense probably benign 0.06
PIT4504001:Lrrc8c UTSW 5 105608537 missense probably benign
PIT4651001:Lrrc8c UTSW 5 105608323 missense probably benign 0.04
R0196:Lrrc8c UTSW 5 105606770 missense probably benign 0.18
R0454:Lrrc8c UTSW 5 105607099 missense probably damaging 1.00
R0565:Lrrc8c UTSW 5 105607028 missense probably damaging 0.98
R0673:Lrrc8c UTSW 5 105607678 missense probably damaging 0.99
R0722:Lrrc8c UTSW 5 105579548 missense probably damaging 1.00
R1177:Lrrc8c UTSW 5 105606836 missense probably benign 0.40
R1411:Lrrc8c UTSW 5 105608179 missense probably damaging 0.96
R1486:Lrrc8c UTSW 5 105607529 missense probably damaging 1.00
R1551:Lrrc8c UTSW 5 105608224 missense probably damaging 1.00
R1662:Lrrc8c UTSW 5 105606757 missense probably benign 0.22
R1714:Lrrc8c UTSW 5 105607291 missense possibly damaging 0.93
R1770:Lrrc8c UTSW 5 105606737 missense probably damaging 1.00
R2104:Lrrc8c UTSW 5 105607358 missense possibly damaging 0.85
R2139:Lrrc8c UTSW 5 105606692 missense probably damaging 1.00
R4425:Lrrc8c UTSW 5 105607889 missense probably benign 0.22
R4670:Lrrc8c UTSW 5 105608374 missense probably benign
R4897:Lrrc8c UTSW 5 105608089 missense probably benign 0.01
R4968:Lrrc8c UTSW 5 105607127 missense probably damaging 1.00
R5114:Lrrc8c UTSW 5 105607483 missense probably damaging 1.00
R5580:Lrrc8c UTSW 5 105607687 missense probably benign 0.00
R5804:Lrrc8c UTSW 5 105579557 missense possibly damaging 0.88
R5918:Lrrc8c UTSW 5 105608251 missense possibly damaging 0.68
R6293:Lrrc8c UTSW 5 105606746 missense probably damaging 1.00
R6303:Lrrc8c UTSW 5 105608609 missense probably benign 0.31
R6304:Lrrc8c UTSW 5 105608609 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AGCATCGCTTACATTCCAGAGCAC -3'
(R):5'- GGGCAGAGTCTCAAACAGAGCATC -3'

Sequencing Primer
(F):5'- GAGAGACTGTTTTTCAGCCAC -3'
(R):5'- GTCTCAAACAGAGCATCTTCCAC -3'
Posted On2013-10-16