Incidental Mutation 'R0815:Myo15b'
ID78581
Institutional Source Beutler Lab
Gene Symbol Myo15b
Ensembl Gene ENSMUSG00000034427
Gene Namemyosin XVB
SynonymsLOC217328, E330039G21Rik, LOC380737
MMRRC Submission 038995-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R0815 (G1)
Quality Score197
Status Validated
Chromosome11
Chromosomal Location115858406-115892603 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to G at 115866336 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000091439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093911]
Predicted Effect probably benign
Transcript: ENSMUST00000093911
SMART Domains Protein: ENSMUSP00000091439
Gene: ENSMUSG00000034427

DomainStartEndE-ValueType
MYSc 1 640 2.4e-134 SMART
IQ 660 682 1.03e1 SMART
Pfam:MyTH4 837 945 2.1e-23 PFAM
low complexity region 1050 1068 N/A INTRINSIC
low complexity region 1136 1170 N/A INTRINSIC
low complexity region 1207 1246 N/A INTRINSIC
low complexity region 1302 1327 N/A INTRINSIC
low complexity region 1454 1468 N/A INTRINSIC
low complexity region 1489 1509 N/A INTRINSIC
SH3 1735 1792 1.15e-7 SMART
Pfam:MyTH4 1928 2029 8.3e-25 PFAM
B41 2032 2235 6.99e-4 SMART
low complexity region 2243 2253 N/A INTRINSIC
Meta Mutation Damage Score 0.0848 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.5%
  • 20x: 91.3%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,351,087 I88L possibly damaging Het
Abcb5 A G 12: 118,901,449 probably benign Het
Abcf2 A T 5: 24,567,270 Y487N probably damaging Het
Adcy4 T C 14: 55,783,599 Y27C probably damaging Het
Atp2a2 T C 5: 122,471,236 I188V probably benign Het
Cacna1s A T 1: 136,112,957 I1231F possibly damaging Het
Capn7 T A 14: 31,369,757 C704S possibly damaging Het
Celsr2 G T 3: 108,401,301 T1770K possibly damaging Het
Chmp7 C T 14: 69,719,450 M336I probably benign Het
Cul9 T C 17: 46,537,822 probably null Het
Dpp10 A G 1: 123,432,929 probably null Het
Dscaml1 A G 9: 45,745,074 I1571V probably benign Het
Eif3j2 T A 18: 43,476,971 Y259F probably benign Het
Erc2 A C 14: 28,025,148 N345T probably benign Het
Fbxo21 T C 5: 117,995,508 probably benign Het
Frmd8 A T 19: 5,865,056 probably benign Het
Gfm1 T C 3: 67,474,595 S705P probably damaging Het
Gucy1b2 T C 14: 62,419,062 D282G probably benign Het
H2-Ab1 T C 17: 34,267,354 I129T probably damaging Het
H2-M10.3 T A 17: 36,366,690 Y232F probably damaging Het
Lipm A T 19: 34,118,761 T326S probably benign Het
Lrrc8c T C 5: 105,608,534 L725P probably damaging Het
Map3k19 A G 1: 127,834,638 probably benign Het
Med31 T A 11: 72,213,831 N50I probably damaging Het
Mgea5 C T 19: 45,782,986 A49T probably benign Het
Nemp1 T C 10: 127,693,024 L199S probably damaging Het
Nod2 G A 8: 88,672,662 probably benign Het
Olfr1444 A G 19: 12,862,644 I290V probably benign Het
Olfr319 A G 11: 58,702,609 R303G possibly damaging Het
Parva G A 7: 112,567,864 V215M probably damaging Het
Phf1 T C 17: 26,937,140 probably benign Het
Ppp1r12c G T 7: 4,486,366 Q240K probably damaging Het
Ralgapa1 A T 12: 55,762,681 Y436* probably null Het
Ralgapa1 C A 12: 55,782,777 probably benign Het
Rbm11 C T 16: 75,596,637 R74C probably damaging Het
Robo3 A G 9: 37,422,183 V744A probably damaging Het
Rsbn1 T G 3: 103,954,153 S522A probably damaging Het
Scel T A 14: 103,586,480 S381R possibly damaging Het
Sec31b G A 19: 44,518,173 Q909* probably null Het
Slc38a11 T A 2: 65,353,780 I176L possibly damaging Het
Slc39a4 C T 15: 76,612,639 D574N probably damaging Het
Slc44a1 T G 4: 53,536,421 V199G possibly damaging Het
Sltm A G 9: 70,561,908 T150A probably benign Het
Son C A 16: 91,655,484 A373D probably damaging Het
Sp140 C T 1: 85,620,051 probably benign Het
Speg A G 1: 75,415,392 Y1606C probably damaging Het
Srgap1 A T 10: 121,785,474 V1061D probably damaging Het
Stat5a A G 11: 100,875,082 probably null Het
Supt4a T A 11: 87,737,583 probably benign Het
Teddm1b A G 1: 153,874,892 K149R possibly damaging Het
Thnsl2 A T 6: 71,134,224 L220* probably null Het
Tinf2 G A 14: 55,680,109 P308S probably benign Het
Tmem131l A G 3: 83,940,572 S329P probably benign Het
Tnf T C 17: 35,201,144 probably benign Het
Upp2 A G 2: 58,771,556 T144A probably benign Het
Vmn2r94 T G 17: 18,257,711 Q146P probably damaging Het
Zfhx4 T A 3: 5,245,315 S919R possibly damaging Het
Other mutations in Myo15b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00556:Myo15b APN 11 115891916 missense possibly damaging 0.69
IGL01409:Myo15b APN 11 115869504 nonsense probably null
IGL01539:Myo15b APN 11 115863473 missense probably benign 0.43
IGL01895:Myo15b APN 11 115883498 missense possibly damaging 0.77
IGL02254:Myo15b APN 11 115886283 missense probably damaging 1.00
IGL02343:Myo15b APN 11 115873400 unclassified probably benign
IGL02349:Myo15b APN 11 115863105 splice site probably benign
IGL02368:Myo15b APN 11 115877002 missense probably benign 0.13
IGL02576:Myo15b APN 11 115890053 missense probably null 0.97
IGL02650:Myo15b APN 11 115886511 critical splice donor site probably null
IGL02661:Myo15b APN 11 115884069 missense probably benign 0.01
IGL02716:Myo15b APN 11 115883709 missense probably benign 0.06
IGL02733:Myo15b APN 11 115884250 missense probably benign 0.00
IGL02951:Myo15b APN 11 115881301 missense probably damaging 1.00
IGL03017:Myo15b APN 11 115887917 missense possibly damaging 0.91
IGL03029:Myo15b APN 11 115871643 missense probably benign 0.08
ANU74:Myo15b UTSW 11 115878413 missense probably damaging 1.00
R0092:Myo15b UTSW 11 115862986 missense possibly damaging 0.90
R0255:Myo15b UTSW 11 115886283 missense probably damaging 1.00
R0325:Myo15b UTSW 11 115884265 missense probably damaging 1.00
R0614:Myo15b UTSW 11 115882913 missense probably damaging 1.00
R0652:Myo15b UTSW 11 115864642 missense probably benign 0.07
R0711:Myo15b UTSW 11 115883838 missense probably damaging 1.00
R0961:Myo15b UTSW 11 115882454 missense probably benign 0.15
R1066:Myo15b UTSW 11 115879751 missense probably benign 0.03
R1221:Myo15b UTSW 11 115886720 missense possibly damaging 0.75
R1240:Myo15b UTSW 11 115880501 missense possibly damaging 0.70
R1275:Myo15b UTSW 11 115883492 small deletion probably benign
R1313:Myo15b UTSW 11 115885129 missense probably damaging 1.00
R1313:Myo15b UTSW 11 115885129 missense probably damaging 1.00
R1317:Myo15b UTSW 11 115883634 missense probably null 0.14
R1491:Myo15b UTSW 11 115886857 splice site probably null
R1552:Myo15b UTSW 11 115866635 missense probably benign 0.08
R1731:Myo15b UTSW 11 115891560 missense possibly damaging 0.57
R1800:Myo15b UTSW 11 115880509 critical splice donor site probably null
R1843:Myo15b UTSW 11 115869586 missense probably benign 0.04
R1888:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1888:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1894:Myo15b UTSW 11 115887073 missense probably damaging 1.00
R1917:Myo15b UTSW 11 115882254 missense possibly damaging 0.51
R1934:Myo15b UTSW 11 115863484 missense probably benign 0.30
R1939:Myo15b UTSW 11 115887703 missense probably benign 0.00
R1945:Myo15b UTSW 11 115878398 missense probably damaging 1.00
R1986:Myo15b UTSW 11 115882875 missense probably benign 0.31
R2130:Myo15b UTSW 11 115871643 missense probably benign 0.08
R2138:Myo15b UTSW 11 115883807 missense probably benign 0.00
R2176:Myo15b UTSW 11 115866572 missense probably damaging 1.00
R2415:Myo15b UTSW 11 115879564 missense probably benign 0.00
R2483:Myo15b UTSW 11 115864739 missense probably benign 0.04
R3620:Myo15b UTSW 11 115871187 missense possibly damaging 0.46
R3716:Myo15b UTSW 11 115863413 missense probably benign 0.01
R4013:Myo15b UTSW 11 115871456 nonsense probably null
R4021:Myo15b UTSW 11 115873505 missense probably benign 0.07
R4119:Myo15b UTSW 11 115873492 missense probably benign 0.07
R4120:Myo15b UTSW 11 115873492 missense probably benign 0.07
R4499:Myo15b UTSW 11 115890952 missense probably benign 0.00
R4653:Myo15b UTSW 11 115879987 critical splice donor site probably null
R4655:Myo15b UTSW 11 115890697 missense probably damaging 1.00
R4700:Myo15b UTSW 11 115861935 missense possibly damaging 0.55
R4702:Myo15b UTSW 11 115884008 missense probably benign 0.01
R4777:Myo15b UTSW 11 115879652 missense probably damaging 0.99
R4833:Myo15b UTSW 11 115887602 missense possibly damaging 0.51
R5083:Myo15b UTSW 11 115866656 missense probably benign 0.01
R5121:Myo15b UTSW 11 115886054 missense probably damaging 1.00
R5146:Myo15b UTSW 11 115891198 missense probably benign 0.00
R5535:Myo15b UTSW 11 115881301 missense probably damaging 1.00
R5647:Myo15b UTSW 11 115871511 missense probably damaging 0.99
R5849:Myo15b UTSW 11 115881933 missense probably damaging 1.00
R5882:Myo15b UTSW 11 115869596 missense probably damaging 1.00
R5956:Myo15b UTSW 11 115873757 missense probably benign 0.34
R6273:Myo15b UTSW 11 115862799 missense possibly damaging 0.63
R6302:Myo15b UTSW 11 115886239 missense possibly damaging 0.88
R6318:Myo15b UTSW 11 115890831 missense probably damaging 1.00
R6462:Myo15b UTSW 11 115859442 missense probably benign 0.01
R6792:Myo15b UTSW 11 115885097 missense probably damaging 1.00
X0020:Myo15b UTSW 11 115871799 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGACTGATGCATGGCTAAGATCCAC -3'
(R):5'- AGAGCTGCACAGGAGAGTATCCTC -3'

Sequencing Primer
(F):5'- CATGGCTAAGATCCACGATGG -3'
(R):5'- CTGTGGTTACTTCAGCCTCT -3'
Posted On2013-10-16