Incidental Mutation 'R0815:Chmp7'
ID78590
Institutional Source Beutler Lab
Gene Symbol Chmp7
Ensembl Gene ENSMUSG00000034190
Gene Namecharged multivesicular body protein 7
Synonyms4930596K11Rik, 6330407G04Rik, CHMP family, member 7
MMRRC Submission 038995-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.387) question?
Stock #R0815 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location69717000-69732541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 69719450 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 336 (M336I)
Ref Sequence ENSEMBL: ENSMUSP00000047700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036381]
Predicted Effect probably benign
Transcript: ENSMUST00000036381
AA Change: M336I

PolyPhen 2 Score 0.380 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000047700
Gene: ENSMUSG00000034190
AA Change: M336I

DomainStartEndE-ValueType
low complexity region 143 163 N/A INTRINSIC
Pfam:Snf7 241 417 1.3e-24 PFAM
low complexity region 420 436 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225036
Meta Mutation Damage Score 0.198 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.5%
  • 20x: 91.3%
Validation Efficiency 97% (58/60)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700057G04Rik A T 9: 92,351,087 I88L possibly damaging Het
Abcb5 A G 12: 118,901,449 probably benign Het
Abcf2 A T 5: 24,567,270 Y487N probably damaging Het
Adcy4 T C 14: 55,783,599 Y27C probably damaging Het
Atp2a2 T C 5: 122,471,236 I188V probably benign Het
Cacna1s A T 1: 136,112,957 I1231F possibly damaging Het
Capn7 T A 14: 31,369,757 C704S possibly damaging Het
Celsr2 G T 3: 108,401,301 T1770K possibly damaging Het
Cul9 T C 17: 46,537,822 probably null Het
Dpp10 A G 1: 123,432,929 probably null Het
Dscaml1 A G 9: 45,745,074 I1571V probably benign Het
Eif3j2 T A 18: 43,476,971 Y259F probably benign Het
Erc2 A C 14: 28,025,148 N345T probably benign Het
Fbxo21 T C 5: 117,995,508 probably benign Het
Frmd8 A T 19: 5,865,056 probably benign Het
Gfm1 T C 3: 67,474,595 S705P probably damaging Het
Gucy1b2 T C 14: 62,419,062 D282G probably benign Het
H2-Ab1 T C 17: 34,267,354 I129T probably damaging Het
H2-M10.3 T A 17: 36,366,690 Y232F probably damaging Het
Lipm A T 19: 34,118,761 T326S probably benign Het
Lrrc8c T C 5: 105,608,534 L725P probably damaging Het
Map3k19 A G 1: 127,834,638 probably benign Het
Med31 T A 11: 72,213,831 N50I probably damaging Het
Mgea5 C T 19: 45,782,986 A49T probably benign Het
Myo15b T G 11: 115,866,336 probably benign Het
Nemp1 T C 10: 127,693,024 L199S probably damaging Het
Nod2 G A 8: 88,672,662 probably benign Het
Olfr1444 A G 19: 12,862,644 I290V probably benign Het
Olfr319 A G 11: 58,702,609 R303G possibly damaging Het
Parva G A 7: 112,567,864 V215M probably damaging Het
Phf1 T C 17: 26,937,140 probably benign Het
Ppp1r12c G T 7: 4,486,366 Q240K probably damaging Het
Ralgapa1 A T 12: 55,762,681 Y436* probably null Het
Ralgapa1 C A 12: 55,782,777 probably benign Het
Rbm11 C T 16: 75,596,637 R74C probably damaging Het
Robo3 A G 9: 37,422,183 V744A probably damaging Het
Rsbn1 T G 3: 103,954,153 S522A probably damaging Het
Scel T A 14: 103,586,480 S381R possibly damaging Het
Sec31b G A 19: 44,518,173 Q909* probably null Het
Slc38a11 T A 2: 65,353,780 I176L possibly damaging Het
Slc39a4 C T 15: 76,612,639 D574N probably damaging Het
Slc44a1 T G 4: 53,536,421 V199G possibly damaging Het
Sltm A G 9: 70,561,908 T150A probably benign Het
Son C A 16: 91,655,484 A373D probably damaging Het
Sp140 C T 1: 85,620,051 probably benign Het
Speg A G 1: 75,415,392 Y1606C probably damaging Het
Srgap1 A T 10: 121,785,474 V1061D probably damaging Het
Stat5a A G 11: 100,875,082 probably null Het
Supt4a T A 11: 87,737,583 probably benign Het
Teddm1b A G 1: 153,874,892 K149R possibly damaging Het
Thnsl2 A T 6: 71,134,224 L220* probably null Het
Tinf2 G A 14: 55,680,109 P308S probably benign Het
Tmem131l A G 3: 83,940,572 S329P probably benign Het
Tnf T C 17: 35,201,144 probably benign Het
Upp2 A G 2: 58,771,556 T144A probably benign Het
Vmn2r94 T G 17: 18,257,711 Q146P probably damaging Het
Zfhx4 T A 3: 5,245,315 S919R possibly damaging Het
Other mutations in Chmp7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01115:Chmp7 APN 14 69721323 missense probably damaging 0.99
IGL01304:Chmp7 APN 14 69718613 missense probably benign 0.08
IGL01339:Chmp7 APN 14 69719406 missense probably damaging 1.00
IGL01818:Chmp7 APN 14 69719167 missense probably damaging 1.00
IGL03005:Chmp7 APN 14 69719828 missense probably damaging 1.00
R0238:Chmp7 UTSW 14 69720997 missense probably damaging 0.98
R0238:Chmp7 UTSW 14 69720997 missense probably damaging 0.98
R0239:Chmp7 UTSW 14 69720997 missense probably damaging 0.98
R0239:Chmp7 UTSW 14 69720997 missense probably damaging 0.98
R0395:Chmp7 UTSW 14 69732456 missense probably benign
R0580:Chmp7 UTSW 14 69719450 missense probably benign 0.38
R1136:Chmp7 UTSW 14 69719450 missense probably benign 0.38
R1137:Chmp7 UTSW 14 69719450 missense probably benign 0.38
R1168:Chmp7 UTSW 14 69719450 missense probably benign 0.38
R1206:Chmp7 UTSW 14 69719450 missense probably benign 0.38
R1260:Chmp7 UTSW 14 69719450 missense probably benign 0.38
R1261:Chmp7 UTSW 14 69719450 missense probably benign 0.38
R1262:Chmp7 UTSW 14 69719450 missense probably benign 0.38
R1460:Chmp7 UTSW 14 69719450 missense probably benign 0.38
R1530:Chmp7 UTSW 14 69732488 start codon destroyed probably null 0.68
R1579:Chmp7 UTSW 14 69719450 missense probably benign 0.38
R1581:Chmp7 UTSW 14 69719450 missense probably benign 0.38
R1843:Chmp7 UTSW 14 69719799 missense probably benign 0.00
R1851:Chmp7 UTSW 14 69719450 missense probably benign 0.38
R2254:Chmp7 UTSW 14 69720956 missense probably damaging 0.96
R4075:Chmp7 UTSW 14 69732281 missense probably damaging 0.99
R4298:Chmp7 UTSW 14 69719201 splice site probably null
R4595:Chmp7 UTSW 14 69721229 missense probably damaging 0.96
R4665:Chmp7 UTSW 14 69720955 missense probably damaging 1.00
R4706:Chmp7 UTSW 14 69718561 missense probably benign 0.45
R4732:Chmp7 UTSW 14 69732296 missense probably damaging 0.98
R4733:Chmp7 UTSW 14 69732296 missense probably damaging 0.98
R5207:Chmp7 UTSW 14 69732306 missense probably benign 0.02
R5358:Chmp7 UTSW 14 69721235 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- TCAGGAACAAGGCTGCGTCAAG -3'
(R):5'- TGCCAAGCTGGACACTGTTCAAG -3'

Sequencing Primer
(F):5'- GTTTGGAAAAGAGGCTTGAAGTCAG -3'
(R):5'- TGGACACTGTTCAAGGCATC -3'
Posted On2013-10-16