Incidental Mutation 'R0819:G530012D18Rik'
ID78622
Institutional Source Beutler Lab
Gene Symbol G530012D18Rik
Ensembl Gene ENSMUSG00000094127
Gene NameRIKEN cDNA G530012D1 gene
Synonyms
MMRRC Submission 038999-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R0819 (G1)
Quality Score129
Status Not validated
Chromosome1
Chromosomal Location85575676-85577295 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CAGAGAGA to CAGAGAGAGA at 85577224 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093508] [ENSMUST00000178024]
Predicted Effect probably benign
Transcript: ENSMUST00000093508
SMART Domains Protein: ENSMUSP00000091226
Gene: ENSMUSG00000070034

DomainStartEndE-ValueType
Pfam:Sp100 8 106 2.3e-41 PFAM
low complexity region 242 254 N/A INTRINSIC
low complexity region 259 269 N/A INTRINSIC
SAND 360 433 3.55e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131950
Predicted Effect probably null
Transcript: ENSMUST00000178024
SMART Domains Protein: ENSMUSP00000136816
Gene: ENSMUSG00000094127

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 82 122 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186740
Meta Mutation Damage Score 0.6432 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 7 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ccdc106 G A 7: 5,059,540 D11N possibly damaging Het
Dock11 G A X: 36,020,035 R1102H probably damaging Het
Mycbp2 C T 14: 103,229,418 R1303Q probably damaging Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Sis T C 3: 72,952,531 Q297R probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Other mutations in G530012D18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4340:G530012D18Rik UTSW 1 85577152 small deletion probably benign
FR4449:G530012D18Rik UTSW 1 85577180 small deletion probably benign
FR4737:G530012D18Rik UTSW 1 85577178 frame shift probably null
IGL03050:G530012D18Rik UTSW 1 85577224 frame shift probably null
PIT4142001:G530012D18Rik UTSW 1 85577204 utr 3 prime probably benign
R0707:G530012D18Rik UTSW 1 85577224 frame shift probably null
R0730:G530012D18Rik UTSW 1 85577036 utr 3 prime probably benign
R1053:G530012D18Rik UTSW 1 85577224 frame shift probably null
R1155:G530012D18Rik UTSW 1 85577224 frame shift probably null
R1236:G530012D18Rik UTSW 1 85577224 frame shift probably null
R1245:G530012D18Rik UTSW 1 85577224 frame shift probably null
R1880:G530012D18Rik UTSW 1 85577224 frame shift probably null
R1961:G530012D18Rik UTSW 1 85577224 frame shift probably null
R2033:G530012D18Rik UTSW 1 85577154 frame shift probably null
R2055:G530012D18Rik UTSW 1 85577224 frame shift probably null
R2510:G530012D18Rik UTSW 1 85577204 utr 3 prime probably benign
R2903:G530012D18Rik UTSW 1 85577224 frame shift probably null
R2989:G530012D18Rik UTSW 1 85577216 frame shift probably null
R3000:G530012D18Rik UTSW 1 85577224 frame shift probably null
R3757:G530012D18Rik UTSW 1 85577224 frame shift probably null
R3914:G530012D18Rik UTSW 1 85577224 frame shift probably null
R4358:G530012D18Rik UTSW 1 85577202 utr 3 prime probably benign
R4407:G530012D18Rik UTSW 1 85577202 utr 3 prime probably benign
R4417:G530012D18Rik UTSW 1 85577202 utr 3 prime probably benign
R5086:G530012D18Rik UTSW 1 85577220 utr 3 prime probably benign
R5389:G530012D18Rik UTSW 1 85577202 utr 3 prime probably benign
X0023:G530012D18Rik UTSW 1 85577224 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACATCGTGAGCGTGTACCACAG -3'
(R):5'- GGGTTTTACCTGGAGAGGATGAACG -3'

Sequencing Primer
(F):5'- CTGGGTCAGTTGTGATGAGGAC -3'
(R):5'- GAGTTACCTTATCACTAAGGGGAAAC -3'
Posted On2013-10-16