Mutagenetix > Incidental Mutation

Incidental Mutation 'R0880:Cdhr1'

80482

Institutional Source

Beutler Lab

Gene Symbol

Cdhr1

Ensembl Gene

ENSMUSG00000021803

Gene Name

cadherin-related family member 1

Synonyms

Prcad, Pcdh21

MMRRC Submission

039047-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.143) question?

Stock #

R0880 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

36799814-36820304 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 36802591 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 624 (D624G)

Ref Sequence

ENSEMBL: ENSMUSP00000022337 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022337]

AlphaFold

Q8VHP6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000022337
AA Change: D624G

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000022337
Gene: ENSMUSG00000021803
AA Change: D624G

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CA	57	133	9.4e-7	SMART
CA	157	245	9.44e-21	SMART
CA	269	352	2.06e-12	SMART
CA	383	471	2.68e-11	SMART
CA	495	575	5.26e-19	SMART
CA	594	685	1.64e-6	SMART
transmembrane domain	703	725	N/A	INTRINSIC
low complexity region	734	745	N/A	INTRINSIC
low complexity region	789	799	N/A	INTRINSIC
low complexity region	817	829	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 96.6%
20x: 92.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the cadherin superfamily of calcium-dependent cell adhesion molecules. The encoded protein is a photoreceptor-specific cadherin that plays a role in outer segment disc morphogenesis. Mutations in this gene are associated with inherited retinal dystrophies. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit progressive degeneration of retinal photoreceptor cells and a slight reduction in light responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 24 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	A	G	6: 128,537,609 (GRCm39)	Y701H	possibly damaging	Het
Akap6	A	G	12: 53,186,291 (GRCm39)	D1235G	possibly damaging	Het
Arhgef18	A	G	8: 3,439,032 (GRCm39)		probably benign	Het
Astn2	A	G	4: 65,566,567 (GRCm39)	Y812H	probably damaging	Het
Bmpr1b	G	T	3: 141,576,557 (GRCm39)	S92*	probably null	Het
Camsap2	T	C	1: 136,208,708 (GRCm39)	D934G	probably benign	Het
Cdh23	A	G	10: 60,242,200 (GRCm39)	V1076A	possibly damaging	Het
Cfap57	A	T	4: 118,439,035 (GRCm39)	Y830*	probably null	Het
Eml3	A	G	19: 8,918,279 (GRCm39)	D790G	possibly damaging	Het
Ess2	A	G	16: 17,729,051 (GRCm39)	V40A	probably damaging	Het
Gucy2c	T	C	6: 136,686,830 (GRCm39)		probably null	Het
Helz2	A	C	2: 180,877,928 (GRCm39)	S957A	probably benign	Het
Ifi209	T	A	1: 173,472,379 (GRCm39)	S407T	probably damaging	Het
Iftap	T	A	2: 101,406,455 (GRCm39)	T158S	probably benign	Het
Muc6	T	C	7: 141,217,270 (GRCm39)	T2403A	possibly damaging	Het
Nfe2	T	C	15: 103,157,689 (GRCm39)	N101D	probably damaging	Het
Nsf	A	T	11: 103,804,198 (GRCm39)	V178D	possibly damaging	Het
P4ha3	A	G	7: 99,955,116 (GRCm39)	T324A	probably benign	Het
Pdia3	G	A	2: 121,262,858 (GRCm39)	G275S	probably damaging	Het
Rhbdf1	T	C	11: 32,163,432 (GRCm39)		probably null	Het
Samd9l	G	A	6: 3,377,064 (GRCm39)	L66F	probably damaging	Het
Speg	T	C	1: 75,381,705 (GRCm39)	F1024S	probably damaging	Het
Sspo	A	G	6: 48,452,869 (GRCm39)	N2859S	possibly damaging	Het
Tnfrsf21	G	A	17: 43,348,733 (GRCm39)	W115*	probably null	Het

Other mutations in Cdhr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00673:Cdhr1	APN	14	36,807,485 (GRCm39)	missense	probably benign	0.06
IGL01820:Cdhr1	APN	14	36,807,536 (GRCm39)	missense	probably benign	0.11
IGL02469:Cdhr1	APN	14	36,807,557 (GRCm39)	missense	possibly damaging	0.68
IGL03373:Cdhr1	APN	14	36,818,257 (GRCm39)	missense	possibly damaging	0.89
IGL03055:Cdhr1	UTSW	14	36,817,054 (GRCm39)	missense	probably benign	0.07
PIT4494001:Cdhr1	UTSW	14	36,804,813 (GRCm39)	missense	probably benign	0.07
R0110:Cdhr1	UTSW	14	36,802,633 (GRCm39)	missense	probably damaging	0.99
R0219:Cdhr1	UTSW	14	36,801,558 (GRCm39)	missense	possibly damaging	0.82
R0265:Cdhr1	UTSW	14	36,803,333 (GRCm39)	missense	probably benign	0.02
R0450:Cdhr1	UTSW	14	36,802,633 (GRCm39)	missense	probably damaging	0.99
R0510:Cdhr1	UTSW	14	36,802,633 (GRCm39)	missense	probably damaging	0.99
R0522:Cdhr1	UTSW	14	36,815,957 (GRCm39)	critical splice donor site	probably null
R0788:Cdhr1	UTSW	14	36,809,332 (GRCm39)	critical splice donor site	probably null
R1209:Cdhr1	UTSW	14	36,804,899 (GRCm39)	splice site	probably null
R1253:Cdhr1	UTSW	14	36,801,582 (GRCm39)	missense	probably benign
R1604:Cdhr1	UTSW	14	36,817,050 (GRCm39)	missense	probably benign	0.29
R1968:Cdhr1	UTSW	14	36,801,682 (GRCm39)	missense	probably benign	0.00
R2064:Cdhr1	UTSW	14	36,817,062 (GRCm39)	missense	probably benign	0.10
R2248:Cdhr1	UTSW	14	36,803,334 (GRCm39)	missense	probably benign
R3843:Cdhr1	UTSW	14	36,806,884 (GRCm39)	missense	probably benign	0.03
R4178:Cdhr1	UTSW	14	36,804,896 (GRCm39)	splice site	probably null
R4205:Cdhr1	UTSW	14	36,802,461 (GRCm39)	missense	probably benign	0.00
R4681:Cdhr1	UTSW	14	36,818,194 (GRCm39)	missense	probably benign	0.01
R5039:Cdhr1	UTSW	14	36,801,600 (GRCm39)	missense	probably benign	0.02
R5088:Cdhr1	UTSW	14	36,811,422 (GRCm39)	missense	probably benign	0.08
R5383:Cdhr1	UTSW	14	36,810,964 (GRCm39)	missense	possibly damaging	0.94
R5507:Cdhr1	UTSW	14	36,804,802 (GRCm39)	missense	probably damaging	0.98
R5933:Cdhr1	UTSW	14	36,811,419 (GRCm39)	missense	probably benign	0.01
R6074:Cdhr1	UTSW	14	36,801,600 (GRCm39)	missense	probably benign	0.02
R6291:Cdhr1	UTSW	14	36,811,422 (GRCm39)	missense	probably benign	0.31
R6449:Cdhr1	UTSW	14	36,812,554 (GRCm39)	missense	probably benign	0.35
R6890:Cdhr1	UTSW	14	36,807,602 (GRCm39)	missense	probably damaging	1.00
R6891:Cdhr1	UTSW	14	36,819,334 (GRCm39)	splice site	probably null
R7653:Cdhr1	UTSW	14	36,804,158 (GRCm39)	missense	probably benign	0.27
R7740:Cdhr1	UTSW	14	36,811,337 (GRCm39)	missense	probably damaging	0.98
R7805:Cdhr1	UTSW	14	36,803,502 (GRCm39)	missense	probably benign	0.00
R8081:Cdhr1	UTSW	14	36,815,967 (GRCm39)	missense	probably benign	0.01
R8147:Cdhr1	UTSW	14	36,801,609 (GRCm39)	missense	probably benign	0.02
R8164:Cdhr1	UTSW	14	36,801,499 (GRCm39)	missense	probably damaging	1.00
R8283:Cdhr1	UTSW	14	36,804,737 (GRCm39)	missense	probably benign	0.00
R8343:Cdhr1	UTSW	14	36,813,935 (GRCm39)	missense	probably benign	0.00
R8848:Cdhr1	UTSW	14	36,802,531 (GRCm39)	missense	probably benign	0.21
R8938:Cdhr1	UTSW	14	36,809,405 (GRCm39)	missense	probably benign	0.17
R9031:Cdhr1	UTSW	14	36,815,976 (GRCm39)	missense	probably benign
R9035:Cdhr1	UTSW	14	36,810,924 (GRCm39)	missense	possibly damaging	0.69
R9206:Cdhr1	UTSW	14	36,802,505 (GRCm39)	missense	probably damaging	0.99
R9246:Cdhr1	UTSW	14	36,801,654 (GRCm39)	missense	possibly damaging	0.46
R9274:Cdhr1	UTSW	14	36,802,564 (GRCm39)	missense	probably benign	0.15
R9366:Cdhr1	UTSW	14	36,811,463 (GRCm39)	missense	possibly damaging	0.92
R9401:Cdhr1	UTSW	14	36,820,055 (GRCm39)	missense	probably benign
R9545:Cdhr1	UTSW	14	36,817,016 (GRCm39)	missense	possibly damaging	0.51
R9713:Cdhr1	UTSW	14	36,801,751 (GRCm39)	missense	probably damaging	1.00
R9797:Cdhr1	UTSW	14	36,803,462 (GRCm39)	missense	probably damaging	1.00
X0062:Cdhr1	UTSW	14	36,801,736 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCCAGAGTCACACCATTAGGTAAC -3'
(R):5'- GCTCAGAGTAGCACATGCTTTCTCC -3'

Sequencing Primer
(F):5'- cacaccattaggtaacattgtgac -3'
(R):5'- GCAAATAGGATCTGAATCCTTTCCC -3'

Posted On

2013-11-07