Incidental Mutation 'R0881:Klhdc4'
ID80554
Institutional Source Beutler Lab
Gene Symbol Klhdc4
Ensembl Gene ENSMUSG00000040263
Gene Namekelch domain containing 4
Synonyms
MMRRC Submission 039048-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R0881 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location121796313-121829569 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 121799487 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 304 (Y304*)
Ref Sequence ENSEMBL: ENSMUSP00000134361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045884] [ENSMUST00000127664] [ENSMUST00000174192] [ENSMUST00000174665] [ENSMUST00000174717]
Predicted Effect probably null
Transcript: ENSMUST00000045884
AA Change: Y335*
SMART Domains Protein: ENSMUSP00000043439
Gene: ENSMUSG00000040263
AA Change: Y335*

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
Pfam:Kelch_4 63 118 8.3e-11 PFAM
Pfam:Kelch_3 75 125 1.7e-9 PFAM
Pfam:Kelch_6 118 174 2.4e-9 PFAM
Pfam:Kelch_4 118 175 3e-8 PFAM
Pfam:Kelch_3 131 185 2e-8 PFAM
Pfam:Kelch_5 173 216 7.5e-9 PFAM
Pfam:Kelch_3 186 239 2.1e-6 PFAM
Pfam:Kelch_1 295 345 4.6e-6 PFAM
Pfam:Kelch_2 295 349 2.1e-7 PFAM
low complexity region 489 520 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172507
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172954
Predicted Effect probably null
Transcript: ENSMUST00000174192
AA Change: Y278*
SMART Domains Protein: ENSMUSP00000134487
Gene: ENSMUSG00000040263
AA Change: Y278*

DomainStartEndE-ValueType
Pfam:Kelch_3 32 70 1.5e-6 PFAM
Pfam:Kelch_6 61 117 1.9e-8 PFAM
Pfam:Kelch_4 61 118 6.9e-8 PFAM
Pfam:Kelch_3 74 128 4.6e-8 PFAM
Pfam:Kelch_5 116 159 1.4e-7 PFAM
Pfam:Kelch_4 119 172 2.2e-6 PFAM
Pfam:Kelch_3 129 182 7e-7 PFAM
Pfam:Kelch_2 238 292 1.8e-7 PFAM
low complexity region 432 463 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174206
Predicted Effect probably benign
Transcript: ENSMUST00000174665
SMART Domains Protein: ENSMUSP00000134474
Gene: ENSMUSG00000040263

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
low complexity region 57 67 N/A INTRINSIC
low complexity region 104 114 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174709
Predicted Effect probably null
Transcript: ENSMUST00000174717
AA Change: Y304*
SMART Domains Protein: ENSMUSP00000134361
Gene: ENSMUSG00000040263
AA Change: Y304*

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
Pfam:Kelch_4 63 117 1.4e-8 PFAM
Pfam:Kelch_3 75 127 9.6e-11 PFAM
Pfam:Kelch_4 118 170 2.3e-7 PFAM
Pfam:Kelch_6 118 174 9.3e-9 PFAM
low complexity region 191 202 N/A INTRINSIC
Pfam:Kelch_2 264 318 2e-7 PFAM
low complexity region 458 489 N/A INTRINSIC
Meta Mutation Damage Score 0.6364 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 93.0%
Validation Efficiency 96% (51/53)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Abcc9 T A 6: 142,646,303 I732F probably damaging Het
Adam10 T C 9: 70,746,237 S248P probably damaging Het
Adam18 A T 8: 24,672,143 probably benign Het
Angel2 G A 1: 190,937,464 E114K probably damaging Het
Arhgap29 A G 3: 122,014,679 T1169A probably damaging Het
Atp13a2 T A 4: 141,003,931 M759K probably damaging Het
Atxn2l A G 7: 126,496,596 S450P probably damaging Het
B3glct T A 5: 149,739,569 V264E probably damaging Het
Bbx A G 16: 50,220,600 probably benign Het
Bmp3 A G 5: 98,872,602 N295D possibly damaging Het
C9 G A 15: 6,458,868 probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cdan1 A T 2: 120,720,985 V1039E probably damaging Het
Dennd4a T C 9: 64,851,383 probably null Het
Ext1 A G 15: 53,344,483 L294P probably benign Het
Fsip2 C A 2: 82,986,273 H4117N possibly damaging Het
Itga8 C T 2: 12,262,192 probably null Het
Itln1 G T 1: 171,533,381 H48N probably benign Het
Kcna5 T A 6: 126,534,994 H57L probably benign Het
Klhl25 A G 7: 75,866,279 Y6C probably damaging Het
Lars C T 18: 42,214,786 V991M probably benign Het
Med20 T C 17: 47,611,680 M1T probably null Het
Mslnl A T 17: 25,742,965 H138L possibly damaging Het
Mycbp2 T C 14: 103,220,013 I1583V probably benign Het
Nipbl A C 15: 8,307,612 V2093G probably damaging Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Olfr340 T G 2: 36,453,440 L285R probably damaging Het
Olfr557 T A 7: 102,699,084 V282D possibly damaging Het
Olfr943 A G 9: 39,184,688 K170R probably benign Het
Opalin T C 19: 41,063,981 probably null Het
Pgm1 A T 5: 64,093,008 T9S unknown Het
Piwil2 A C 14: 70,408,927 S387A probably benign Het
Polr1c T C 17: 46,244,613 T240A possibly damaging Het
Polr3c A G 3: 96,723,847 M118T probably damaging Het
Pth1r C T 9: 110,731,573 C42Y probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rictor A T 15: 6,791,670 M1492L probably benign Het
Rrbp1 T A 2: 143,953,253 Y1277F probably benign Het
Scgb3a2 T G 18: 43,764,484 probably benign Het
Skint1 G A 4: 112,028,857 S327N probably benign Het
Steap4 A T 5: 7,980,388 S415C probably benign Het
Tex48 A G 4: 63,611,991 probably benign Het
Tox2 T A 2: 163,321,445 S502T probably benign Het
Usp47 T A 7: 112,091,436 I762K possibly damaging Het
Vmn2r53 T C 7: 12,600,932 H267R probably benign Het
Wnt2b A G 3: 104,953,197 probably benign Het
Xirp1 T C 9: 120,018,417 N28D possibly damaging Het
Zeb1 T C 18: 5,767,138 S550P probably benign Het
Other mutations in Klhdc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Klhdc4 APN 8 121821843 nonsense probably null
IGL01678:Klhdc4 APN 8 121796938 missense possibly damaging 0.73
kilimanjaro UTSW 8 121813790 nonsense probably null
R0577:Klhdc4 UTSW 8 121821351 missense probably damaging 0.99
R1710:Klhdc4 UTSW 8 121799487 nonsense probably null
R2993:Klhdc4 UTSW 8 121806581 nonsense probably null
R3028:Klhdc4 UTSW 8 121799549 missense probably damaging 1.00
R3109:Klhdc4 UTSW 8 121821334 missense probably damaging 1.00
R3711:Klhdc4 UTSW 8 121798055 missense probably benign
R4132:Klhdc4 UTSW 8 121798065 missense possibly damaging 0.79
R4601:Klhdc4 UTSW 8 121799527 missense probably damaging 1.00
R4644:Klhdc4 UTSW 8 121822000 intron probably benign
R4758:Klhdc4 UTSW 8 121798044 missense probably benign 0.00
R4999:Klhdc4 UTSW 8 121796603 missense probably benign 0.00
R5177:Klhdc4 UTSW 8 121813790 nonsense probably null
R5364:Klhdc4 UTSW 8 121806636 intron probably benign
R5475:Klhdc4 UTSW 8 121799572 missense possibly damaging 0.67
R5705:Klhdc4 UTSW 8 121804993 missense probably benign 0.01
R6248:Klhdc4 UTSW 8 121813768 missense probably damaging 1.00
R6326:Klhdc4 UTSW 8 121805054 missense probably damaging 1.00
R6626:Klhdc4 UTSW 8 121820162 missense probably benign 0.43
R7274:Klhdc4 UTSW 8 121799658 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTGACATCAAGAAGGAACGGGCTAC -3'
(R):5'- GACGCTTGAAATTATGCTCCCGC -3'

Sequencing Primer
(F):5'- GCTACAAAGCCAAAAGGGTC -3'
(R):5'- CTTTCCTTACAGGCAAATGGG -3'
Posted On2013-11-07