Incidental Mutation 'R0881:Bbx'
ID80578
Institutional Source Beutler Lab
Gene Symbol Bbx
Ensembl Gene ENSMUSG00000022641
Gene Namebobby sox HMG box containing
Synonyms5730403O13Rik, 5530401J07Rik
MMRRC Submission 039048-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.310) question?
Stock #R0881 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location50191844-50432390 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 50220600 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066037] [ENSMUST00000089399] [ENSMUST00000089404] [ENSMUST00000114477] [ENSMUST00000114488] [ENSMUST00000138166]
Predicted Effect probably benign
Transcript: ENSMUST00000066037
SMART Domains Protein: ENSMUSP00000066384
Gene: ENSMUSG00000022641

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
Pfam:DUF2028 109 150 3.1e-22 PFAM
Pfam:DUF2028 140 214 4.4e-26 PFAM
low complexity region 216 230 N/A INTRINSIC
low complexity region 336 348 N/A INTRINSIC
low complexity region 415 432 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 561 566 N/A INTRINSIC
low complexity region 780 795 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089399
SMART Domains Protein: ENSMUSP00000086821
Gene: ENSMUSG00000022641

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
HMG 79 149 2.76e-15 SMART
Pfam:DUF2028 190 322 2.8e-64 PFAM
low complexity region 324 338 N/A INTRINSIC
low complexity region 444 456 N/A INTRINSIC
low complexity region 523 540 N/A INTRINSIC
low complexity region 636 647 N/A INTRINSIC
low complexity region 669 674 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089404
SMART Domains Protein: ENSMUSP00000086826
Gene: ENSMUSG00000022641

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
HMG 79 149 2.76e-15 SMART
Pfam:DUF2028 190 322 3.7e-64 PFAM
low complexity region 324 338 N/A INTRINSIC
low complexity region 444 456 N/A INTRINSIC
low complexity region 523 540 N/A INTRINSIC
low complexity region 636 647 N/A INTRINSIC
low complexity region 669 674 N/A INTRINSIC
low complexity region 838 853 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114477
SMART Domains Protein: ENSMUSP00000110121
Gene: ENSMUSG00000022641

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
HMG 79 149 2.76e-15 SMART
Pfam:DUF2028 190 322 6.8e-64 PFAM
low complexity region 324 338 N/A INTRINSIC
low complexity region 444 456 N/A INTRINSIC
low complexity region 523 540 N/A INTRINSIC
low complexity region 636 647 N/A INTRINSIC
low complexity region 669 674 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114488
SMART Domains Protein: ENSMUSP00000110132
Gene: ENSMUSG00000022641

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
HMG 79 149 2.76e-15 SMART
Pfam:DUF2028 190 322 3.8e-64 PFAM
low complexity region 324 338 N/A INTRINSIC
low complexity region 444 456 N/A INTRINSIC
low complexity region 523 540 N/A INTRINSIC
low complexity region 636 647 N/A INTRINSIC
low complexity region 669 674 N/A INTRINSIC
low complexity region 723 734 N/A INTRINSIC
low complexity region 858 873 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131695
Predicted Effect probably benign
Transcript: ENSMUST00000138166
SMART Domains Protein: ENSMUSP00000119238
Gene: ENSMUSG00000022641

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
HMG 79 149 2.76e-15 SMART
Pfam:DUF2028 190 335 9.2e-54 PFAM
low complexity region 444 456 N/A INTRINSIC
low complexity region 523 540 N/A INTRINSIC
low complexity region 636 647 N/A INTRINSIC
low complexity region 669 674 N/A INTRINSIC
low complexity region 723 734 N/A INTRINSIC
low complexity region 858 873 N/A INTRINSIC
Meta Mutation Damage Score 0.0492 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.9%
  • 10x: 97.0%
  • 20x: 93.0%
Validation Efficiency 96% (51/53)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele show increased IgA level, abnormal tooth morphology, and a reduction in heart weight, lean body mass, body length, long bone length, bone mineral density, and bone strength. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Abcc9 T A 6: 142,646,303 I732F probably damaging Het
Adam10 T C 9: 70,746,237 S248P probably damaging Het
Adam18 A T 8: 24,672,143 probably benign Het
Angel2 G A 1: 190,937,464 E114K probably damaging Het
Arhgap29 A G 3: 122,014,679 T1169A probably damaging Het
Atp13a2 T A 4: 141,003,931 M759K probably damaging Het
Atxn2l A G 7: 126,496,596 S450P probably damaging Het
B3glct T A 5: 149,739,569 V264E probably damaging Het
Bmp3 A G 5: 98,872,602 N295D possibly damaging Het
C9 G A 15: 6,458,868 probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cdan1 A T 2: 120,720,985 V1039E probably damaging Het
Dennd4a T C 9: 64,851,383 probably null Het
Ext1 A G 15: 53,344,483 L294P probably benign Het
Fsip2 C A 2: 82,986,273 H4117N possibly damaging Het
Itga8 C T 2: 12,262,192 probably null Het
Itln1 G T 1: 171,533,381 H48N probably benign Het
Kcna5 T A 6: 126,534,994 H57L probably benign Het
Klhdc4 A T 8: 121,799,487 Y304* probably null Het
Klhl25 A G 7: 75,866,279 Y6C probably damaging Het
Lars C T 18: 42,214,786 V991M probably benign Het
Med20 T C 17: 47,611,680 M1T probably null Het
Mslnl A T 17: 25,742,965 H138L possibly damaging Het
Mycbp2 T C 14: 103,220,013 I1583V probably benign Het
Nipbl A C 15: 8,307,612 V2093G probably damaging Het
Nup98 T A 7: 102,160,716 T536S probably damaging Het
Olfr340 T G 2: 36,453,440 L285R probably damaging Het
Olfr557 T A 7: 102,699,084 V282D possibly damaging Het
Olfr943 A G 9: 39,184,688 K170R probably benign Het
Opalin T C 19: 41,063,981 probably null Het
Pgm1 A T 5: 64,093,008 T9S unknown Het
Piwil2 A C 14: 70,408,927 S387A probably benign Het
Polr1c T C 17: 46,244,613 T240A possibly damaging Het
Polr3c A G 3: 96,723,847 M118T probably damaging Het
Pth1r C T 9: 110,731,573 C42Y probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Rictor A T 15: 6,791,670 M1492L probably benign Het
Rrbp1 T A 2: 143,953,253 Y1277F probably benign Het
Scgb3a2 T G 18: 43,764,484 probably benign Het
Skint1 G A 4: 112,028,857 S327N probably benign Het
Steap4 A T 5: 7,980,388 S415C probably benign Het
Tex48 A G 4: 63,611,991 probably benign Het
Tox2 T A 2: 163,321,445 S502T probably benign Het
Usp47 T A 7: 112,091,436 I762K possibly damaging Het
Vmn2r53 T C 7: 12,600,932 H267R probably benign Het
Wnt2b A G 3: 104,953,197 probably benign Het
Xirp1 T C 9: 120,018,417 N28D possibly damaging Het
Zeb1 T C 18: 5,767,138 S550P probably benign Het
Other mutations in Bbx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01403:Bbx APN 16 50202513 missense probably benign 0.08
IGL01544:Bbx APN 16 50274777 nonsense probably null
IGL02073:Bbx APN 16 50202491 missense probably damaging 1.00
IGL02302:Bbx APN 16 50224915 missense probably damaging 1.00
IGL02566:Bbx APN 16 50223240 splice site probably benign
IGL02618:Bbx APN 16 50247798 missense probably damaging 1.00
IGL03187:Bbx APN 16 50274563 missense probably damaging 0.96
IGL03215:Bbx APN 16 50202572 missense probably damaging 1.00
IGL03295:Bbx APN 16 50224564 missense probably damaging 1.00
PIT4378001:Bbx UTSW 16 50280473 nonsense probably null
R0024:Bbx UTSW 16 50224918 missense probably benign
R0024:Bbx UTSW 16 50224918 missense probably benign
R0071:Bbx UTSW 16 50280392 missense probably benign 0.32
R0071:Bbx UTSW 16 50280392 missense probably benign 0.32
R0143:Bbx UTSW 16 50280392 missense probably benign 0.32
R0144:Bbx UTSW 16 50280392 missense probably benign 0.32
R0374:Bbx UTSW 16 50280392 missense probably benign 0.32
R0532:Bbx UTSW 16 50266284 missense probably damaging 1.00
R0550:Bbx UTSW 16 50274533 splice site probably benign
R0762:Bbx UTSW 16 50225166 missense possibly damaging 0.94
R1448:Bbx UTSW 16 50266270 nonsense probably null
R1916:Bbx UTSW 16 50266245 missense probably damaging 1.00
R1983:Bbx UTSW 16 50209117 missense possibly damaging 0.62
R2006:Bbx UTSW 16 50224395 missense possibly damaging 0.93
R2095:Bbx UTSW 16 50224689 missense possibly damaging 0.88
R2145:Bbx UTSW 16 50274544 splice site probably benign
R2475:Bbx UTSW 16 50220519 missense probably damaging 0.99
R2892:Bbx UTSW 16 50224741 missense probably damaging 1.00
R4130:Bbx UTSW 16 50224858 missense probably damaging 1.00
R4177:Bbx UTSW 16 50224858 missense probably damaging 1.00
R4486:Bbx UTSW 16 50200414 missense probably damaging 1.00
R4989:Bbx UTSW 16 50224738 missense probably damaging 1.00
R5005:Bbx UTSW 16 50266351 missense probably damaging 1.00
R5427:Bbx UTSW 16 50280497 missense probably benign
R5582:Bbx UTSW 16 50223356 missense probably damaging 1.00
R6063:Bbx UTSW 16 50251367 missense probably benign
R6216:Bbx UTSW 16 50251388 missense probably benign 0.00
R6246:Bbx UTSW 16 50224660 missense probably benign 0.04
R6618:Bbx UTSW 16 50266263 missense probably damaging 1.00
R6782:Bbx UTSW 16 50200565 missense probably benign 0.00
R7007:Bbx UTSW 16 50202488 missense possibly damaging 0.67
X0021:Bbx UTSW 16 50247805 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- AGAGGCCACTGCTAACCTTTGC -3'
(R):5'- TCCCTAACTTTGCCAGTCAGTTGTG -3'

Sequencing Primer
(F):5'- GCTAACCTTTGCTGGTTTTAGTC -3'
(R):5'- CTTTAGAATGAGACCCGTCTGAGTAG -3'
Posted On2013-11-07