Incidental Mutation 'R0928:2010300C02Rik'
ID80582
Institutional Source Beutler Lab
Gene Symbol 2010300C02Rik
Ensembl Gene ENSMUSG00000026090
Gene NameRIKEN cDNA 2010300C02 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R0928 (G1)
Quality Score81
Status Not validated
Chromosome1
Chromosomal Location37611677-37720085 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37624582 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 745 (D745G)
Ref Sequence ENSEMBL: ENSMUSP00000123803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000162875]
Predicted Effect unknown
Transcript: ENSMUST00000160023
AA Change: D220G
SMART Domains Protein: ENSMUSP00000125015
Gene: ENSMUSG00000026090
AA Change: D220G

DomainStartEndE-ValueType
internal_repeat_1 2 65 4.52e-24 PROSPERO
internal_repeat_1 65 128 4.52e-24 PROSPERO
low complexity region 181 194 N/A INTRINSIC
low complexity region 223 237 N/A INTRINSIC
low complexity region 263 279 N/A INTRINSIC
low complexity region 441 465 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162875
AA Change: D745G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123803
Gene: ENSMUSG00000026090
AA Change: D745G

DomainStartEndE-ValueType
low complexity region 13 43 N/A INTRINSIC
Pfam:DUF4592 130 243 1.8e-33 PFAM
low complexity region 347 366 N/A INTRINSIC
internal_repeat_2 387 461 2.31e-5 PROSPERO
internal_repeat_3 404 474 3.67e-5 PROSPERO
internal_repeat_1 411 526 3.02e-34 PROSPERO
internal_repeat_2 485 559 2.31e-5 PROSPERO
internal_repeat_1 537 652 3.02e-34 PROSPERO
internal_repeat_3 570 698 3.67e-5 PROSPERO
low complexity region 705 718 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 787 803 N/A INTRINSIC
low complexity region 965 989 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.1%
  • 10x: 93.0%
  • 20x: 75.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A T 7: 34,248,246 probably null Het
Abca12 T A 1: 71,349,174 D179V probably benign Het
Abcc1 T C 16: 14,389,985 probably null Het
Adad1 G A 3: 37,076,740 probably null Het
Apobec4 T C 1: 152,756,277 Y19H probably damaging Het
Bco2 T A 9: 50,545,931 T104S probably damaging Het
Bnc1 A G 7: 81,973,502 V659A probably benign Het
Ccdc144b A C 3: 36,025,366 N258K possibly damaging Het
Ccs T C 19: 4,825,960 E184G probably damaging Het
Cfap70 T G 14: 20,443,919 K97N probably damaging Het
Daam2 T C 17: 49,488,227 I313V probably benign Het
Dach1 T C 14: 97,915,832 S467G probably damaging Het
Dnah11 A G 12: 118,045,562 S2122P probably damaging Het
Dnah3 T A 7: 120,030,051 D1427V probably damaging Het
Dnaic1 T C 4: 41,602,566 F97L possibly damaging Het
Dsc1 A T 18: 20,110,249 probably null Het
En2 A T 5: 28,170,331 K291* probably null Het
Eps15 T C 4: 109,312,963 V154A possibly damaging Het
Etnk1 A G 6: 143,184,703 I183V probably benign Het
Fcrlb A T 1: 170,907,940 V255D possibly damaging Het
Fry A T 5: 150,437,084 E52V probably damaging Het
Gm8251 C A 1: 44,057,228 S1570I possibly damaging Het
Gtf2h4 T C 17: 35,670,885 Y152C probably damaging Het
Hao1 C A 2: 134,505,616 L256F possibly damaging Het
Helz T A 11: 107,626,693 I685K probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Izumo2 A T 7: 44,715,423 I171F possibly damaging Het
Krt83 C A 15: 101,491,280 C57F probably benign Het
Mapkbp1 A G 2: 120,015,368 H400R probably benign Het
Megf6 T A 4: 154,177,047 V43E probably damaging Het
Mut T C 17: 40,937,283 I67T probably benign Het
Ninl A T 2: 150,963,475 V396E probably damaging Het
Nvl A T 1: 181,093,902 V844E probably benign Het
Olfr11 C T 13: 21,638,956 C189Y probably damaging Het
P2rx3 A T 2: 85,035,298 M1K probably null Het
Pabpn1l T C 8: 122,622,619 T20A probably benign Het
Ppp3r2 C A 4: 49,681,439 probably null Het
Prmt6 C T 3: 110,250,682 G97D probably damaging Het
Prmt9 T C 8: 77,581,176 V823A probably damaging Het
Skint11 C A 4: 114,244,601 D79E possibly damaging Het
Slc17a8 T A 10: 89,598,683 H194L probably damaging Het
Slco6c1 T A 1: 97,104,848 I293F possibly damaging Het
Tcl1b4 A T 12: 105,202,606 H43L probably benign Het
Tm9sf1 T C 14: 55,636,457 D528G probably damaging Het
Tpbpb C T 13: 60,902,175 V47I probably benign Het
Ttc37 T G 13: 76,113,592 L142W probably damaging Het
Ttn G T 2: 76,907,532 probably benign Het
Usp28 T G 9: 49,030,891 S341A possibly damaging Het
Vwa5a T C 9: 38,728,007 Y345H probably damaging Het
Wdr11 C A 7: 129,606,653 D377E probably damaging Het
Zer1 A G 2: 30,101,763 probably null Het
Other mutations in 2010300C02Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01376:2010300C02Rik APN 1 37628344 missense probably damaging 0.99
IGL01413:2010300C02Rik APN 1 37612306 missense possibly damaging 0.85
IGL01812:2010300C02Rik APN 1 37625365 missense probably benign 0.06
IGL02183:2010300C02Rik APN 1 37625378 missense possibly damaging 0.93
IGL02498:2010300C02Rik APN 1 37623845 missense probably benign
IGL02713:2010300C02Rik APN 1 37624137 missense possibly damaging 0.72
IGL02736:2010300C02Rik APN 1 37637873 missense probably damaging 1.00
FR4449:2010300C02Rik UTSW 1 37625035 missense probably benign 0.40
FR4449:2010300C02Rik UTSW 1 37625036 nonsense probably null
FR4548:2010300C02Rik UTSW 1 37625035 missense probably benign 0.40
FR4548:2010300C02Rik UTSW 1 37625036 nonsense probably null
FR4548:2010300C02Rik UTSW 1 37625102 missense probably damaging 0.96
FR4737:2010300C02Rik UTSW 1 37625035 missense probably benign 0.40
FR4737:2010300C02Rik UTSW 1 37625036 nonsense probably null
FR4976:2010300C02Rik UTSW 1 37625035 missense probably benign 0.40
FR4976:2010300C02Rik UTSW 1 37625036 nonsense probably null
FR4976:2010300C02Rik UTSW 1 37625102 missense probably damaging 0.96
R0022:2010300C02Rik UTSW 1 37628245 missense probably damaging 1.00
R0022:2010300C02Rik UTSW 1 37628245 missense probably damaging 1.00
R0055:2010300C02Rik UTSW 1 37624256 missense probably benign 0.18
R0153:2010300C02Rik UTSW 1 37624639 missense probably benign
R0523:2010300C02Rik UTSW 1 37644629 start codon destroyed probably null 0.94
R0699:2010300C02Rik UTSW 1 37612330 missense possibly damaging 0.85
R1457:2010300C02Rik UTSW 1 37626012 nonsense probably null
R1759:2010300C02Rik UTSW 1 37625710 missense probably benign 0.00
R1888:2010300C02Rik UTSW 1 37624283 missense possibly damaging 0.53
R1888:2010300C02Rik UTSW 1 37624283 missense possibly damaging 0.53
R2289:2010300C02Rik UTSW 1 37612261 missense possibly damaging 0.53
R2421:2010300C02Rik UTSW 1 37613475 missense probably benign 0.33
R2422:2010300C02Rik UTSW 1 37613475 missense probably benign 0.33
R2509:2010300C02Rik UTSW 1 37625300 missense probably benign
R2510:2010300C02Rik UTSW 1 37625300 missense probably benign
R2511:2010300C02Rik UTSW 1 37625300 missense probably benign
R3893:2010300C02Rik UTSW 1 37631458 missense probably benign 0.00
R4351:2010300C02Rik UTSW 1 37624912 missense probably benign
R4454:2010300C02Rik UTSW 1 37624753 missense probably damaging 1.00
R4788:2010300C02Rik UTSW 1 37631475 missense probably damaging 1.00
R4798:2010300C02Rik UTSW 1 37624965 missense probably benign 0.12
R5599:2010300C02Rik UTSW 1 37613343 missense possibly damaging 0.53
R5920:2010300C02Rik UTSW 1 37637981 missense probably damaging 1.00
R6051:2010300C02Rik UTSW 1 37624225 missense probably damaging 0.98
R6106:2010300C02Rik UTSW 1 37613412 missense possibly damaging 0.53
R6794:2010300C02Rik UTSW 1 37637855 splice site probably null
R6828:2010300C02Rik UTSW 1 37624817 missense possibly damaging 0.53
R6930:2010300C02Rik UTSW 1 37624945 missense possibly damaging 0.73
X0025:2010300C02Rik UTSW 1 37624945 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AGTTTTGAGGGTCACCACCCATTG -3'
(R):5'- TCATGGAGCCTCCTAATAGGGACAC -3'

Sequencing Primer
(F):5'- TTTGGCAGCACCTGAAGGTC -3'
(R):5'- TTGGAGACACCTTCAGATACAG -3'
Posted On2013-11-07