Incidental Mutation 'R0882:Gdpd4'
ID80637
Institutional Source Beutler Lab
Gene Symbol Gdpd4
Ensembl Gene ENSMUSG00000035582
Gene Nameglycerophosphodiester phosphodiesterase domain containing 4
Synonyms
MMRRC Submission 039049-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R0882 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location97919955-98049663 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97966298 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 110 (I110T)
Ref Sequence ENSEMBL: ENSMUSP00000131960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041860] [ENSMUST00000170049]
Predicted Effect probably damaging
Transcript: ENSMUST00000041860
AA Change: I110T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036772
Gene: ENSMUSG00000035582
AA Change: I110T

DomainStartEndE-ValueType
transmembrane domain 65 84 N/A INTRINSIC
transmembrane domain 104 135 N/A INTRINSIC
transmembrane domain 148 168 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
transmembrane domain 241 263 N/A INTRINSIC
Pfam:GDPD 281 440 1.4e-19 PFAM
transmembrane domain 543 565 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170049
AA Change: I110T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131960
Gene: ENSMUSG00000035582
AA Change: I110T

DomainStartEndE-ValueType
transmembrane domain 65 84 N/A INTRINSIC
transmembrane domain 104 135 N/A INTRINSIC
transmembrane domain 148 168 N/A INTRINSIC
transmembrane domain 183 205 N/A INTRINSIC
transmembrane domain 241 263 N/A INTRINSIC
Pfam:GDPD 281 439 3.4e-21 PFAM
transmembrane domain 543 565 N/A INTRINSIC
Meta Mutation Damage Score 0.086 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Adh1 A T 3: 138,286,797 I225F possibly damaging Het
Agap2 A G 10: 127,087,450 K691E unknown Het
Alcam T C 16: 52,253,210 D564G possibly damaging Het
Apbb2 T A 5: 66,400,255 T289S probably damaging Het
BC005561 T C 5: 104,519,009 S466P probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cep68 T C 11: 20,239,393 I540V probably benign Het
Ctla4 T C 1: 60,909,238 V23A probably benign Het
Dnah7b T A 1: 46,340,132 D3675E probably benign Het
Fam209 G T 2: 172,472,635 V15F probably benign Het
Fat3 A G 9: 16,031,368 V1236A possibly damaging Het
Gabbr2 A G 4: 46,718,904 I38T probably damaging Het
Gm4841 C T 18: 60,269,780 A414T possibly damaging Het
Gtf3c4 A T 2: 28,834,770 Y176N probably damaging Het
Hist2h2bb G A 3: 96,269,744 probably null Het
Igsf9b T C 9: 27,319,316 Y264H probably damaging Het
Itih4 A T 14: 30,892,274 N394Y probably damaging Het
Kmt2c T C 5: 25,295,607 T3815A possibly damaging Het
Lrwd1 T C 5: 136,123,400 probably null Het
Mc3r A G 2: 172,249,791 K311R probably benign Het
Myb T C 10: 21,156,360 T41A possibly damaging Het
Nfix T C 8: 84,727,925 D201G probably damaging Het
Nos1 T C 5: 117,947,447 V1280A probably damaging Het
Olfr160 T C 9: 37,711,872 M136V probably benign Het
Olfr586 A C 7: 103,122,575 S66A probably benign Het
Pcdh15 A G 10: 74,342,656 T582A probably damaging Het
Pcdhb12 C A 18: 37,437,322 A507E probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pkp2 C A 16: 16,269,711 A753E probably damaging Het
Plekha3 G A 2: 76,682,798 V76I possibly damaging Het
Pnpla6 T C 8: 3,517,081 L33P probably damaging Het
Pot1b C T 17: 55,666,400 probably benign Het
Prr5l T C 2: 101,758,541 E88G possibly damaging Het
Prss57 G A 10: 79,785,865 H97Y probably damaging Het
Rttn C T 18: 88,973,689 Q131* probably null Het
Scaf11 G T 15: 96,418,295 S1129R possibly damaging Het
Slc25a20 T A 9: 108,681,990 M185K possibly damaging Het
Sorbs3 T A 14: 70,207,572 E19V probably damaging Het
Srgap2 A T 1: 131,289,515 C1020S probably benign Het
Tmem109 T C 19: 10,871,841 R217G possibly damaging Het
Trio A T 15: 27,732,894 I2967N probably damaging Het
Vars2 T C 17: 35,657,299 E899G probably benign Het
Vmn2r109 A G 17: 20,554,580 probably benign Het
Vps53 A G 11: 76,082,659 F170L probably damaging Het
Zc2hc1a G A 3: 7,526,362 S149N possibly damaging Het
Zfp820 A G 17: 21,823,836 probably benign Het
Zhx3 A C 2: 160,780,709 F513V probably damaging Het
Other mutations in Gdpd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Gdpd4 APN 7 98004271 missense probably damaging 1.00
IGL01292:Gdpd4 APN 7 98014954 splice site probably benign
IGL01317:Gdpd4 APN 7 97998258 missense possibly damaging 0.74
IGL02678:Gdpd4 APN 7 97974377 splice site probably benign
IGL02822:Gdpd4 APN 7 97971924 missense possibly damaging 0.82
IGL02987:Gdpd4 APN 7 97961551 splice site probably benign
R0022:Gdpd4 UTSW 7 97982875 missense probably damaging 1.00
R0331:Gdpd4 UTSW 7 97973008 missense probably benign 0.11
R1425:Gdpd4 UTSW 7 97974012 missense probably benign 0.03
R1469:Gdpd4 UTSW 7 97974466 splice site probably null
R1469:Gdpd4 UTSW 7 97974466 splice site probably null
R1870:Gdpd4 UTSW 7 97972955 missense probably benign 0.00
R4747:Gdpd4 UTSW 7 97961633 missense possibly damaging 0.80
R5017:Gdpd4 UTSW 7 98004275 nonsense probably null
R5208:Gdpd4 UTSW 7 98014911 missense probably benign 0.11
R5290:Gdpd4 UTSW 7 97966336 missense possibly damaging 0.94
R5398:Gdpd4 UTSW 7 97971978 missense probably benign 0.00
R5605:Gdpd4 UTSW 7 98006300 missense probably benign 0.41
R5715:Gdpd4 UTSW 7 97961597 missense probably benign 0.00
R5990:Gdpd4 UTSW 7 98040930 missense probably benign 0.00
R6269:Gdpd4 UTSW 7 97974462 missense probably damaging 1.00
R6314:Gdpd4 UTSW 7 97973953 missense probably damaging 0.98
R6817:Gdpd4 UTSW 7 97957830 missense probably benign 0.00
R6884:Gdpd4 UTSW 7 97972175 missense probably damaging 1.00
R7054:Gdpd4 UTSW 7 97973929 missense probably damaging 0.99
Z1088:Gdpd4 UTSW 7 97966309 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGGACCTGGATGAGGAGCTTGAA -3'
(R):5'- TGTGCATGAAATTGAAGGAGATGGTGT -3'

Sequencing Primer
(F):5'- gactgaccctctgaacctg -3'
(R):5'- GGAGATGGTGTAAATTCCAACTC -3'
Posted On2013-11-07