Incidental Mutation 'R0882:Nfix'
ID80643
Institutional Source Beutler Lab
Gene Symbol Nfix
Ensembl Gene ENSMUSG00000001911
Gene Namenuclear factor I/X
Synonyms
MMRRC Submission 039049-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.330) question?
Stock #R0882 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location84699876-84800344 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84727925 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 201 (D201G)
Ref Sequence ENSEMBL: ENSMUSP00000115691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076715] [ENSMUST00000098571] [ENSMUST00000099070] [ENSMUST00000109762] [ENSMUST00000109764] [ENSMUST00000126806]
Predicted Effect probably damaging
Transcript: ENSMUST00000076715
AA Change: D201G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076005
Gene: ENSMUSG00000001911
AA Change: D201G

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 4.1e-30 PFAM
DWA 67 175 1.86e-18 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:CTF_NFI 213 322 7.4e-32 PFAM
Pfam:CTF_NFI 313 396 3.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098571
SMART Domains Protein: ENSMUSP00000096170
Gene: ENSMUSG00000074203

DomainStartEndE-ValueType
low complexity region 21 31 N/A INTRINSIC
low complexity region 34 51 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 91 103 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099070
AA Change: D201G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096669
Gene: ENSMUSG00000001911
AA Change: D201G

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 4.7e-30 PFAM
DWA 67 175 1.86e-18 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:CTF_NFI 213 437 2.7e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109762
AA Change: D193G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105384
Gene: ENSMUSG00000001911
AA Change: D193G

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 1 38 1.1e-27 PFAM
DWA 59 167 1.86e-18 SMART
low complexity region 180 191 N/A INTRINSIC
Pfam:CTF_NFI 205 312 5.4e-32 PFAM
Pfam:CTF_NFI 305 387 3.6e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109764
AA Change: D193G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105386
Gene: ENSMUSG00000001911
AA Change: D193G

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 1 38 1e-28 PFAM
DWA 59 167 1.86e-18 SMART
low complexity region 180 191 N/A INTRINSIC
Pfam:CTF_NFI 205 494 9.8e-137 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126806
AA Change: D201G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115691
Gene: ENSMUSG00000001911
AA Change: D201G

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 7.1e-31 PFAM
DWA 67 175 1.86e-18 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:CTF_NFI 213 488 1.5e-83 PFAM
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.0%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3 in viral and cellular promoters. The encoded protein can also stimulate adenovirus replication in vitro. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a mutation in this gene display postnatal lethality, hydrocephalus, partial agenesis of the corpus callosum, deformation of the spine due to delayed vertebral body ossification, degeneration of intervertebral disks, decreased mineralization and impaired endochondral ossification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh G A 5: 76,876,283 T174M probably damaging Het
Adh1 A T 3: 138,286,797 I225F possibly damaging Het
Agap2 A G 10: 127,087,450 K691E unknown Het
Alcam T C 16: 52,253,210 D564G possibly damaging Het
Apbb2 T A 5: 66,400,255 T289S probably damaging Het
BC005561 T C 5: 104,519,009 S466P probably benign Het
Cacna1c C T 6: 118,612,625 R1446H probably damaging Het
Cep68 T C 11: 20,239,393 I540V probably benign Het
Ctla4 T C 1: 60,909,238 V23A probably benign Het
Dnah7b T A 1: 46,340,132 D3675E probably benign Het
Fam209 G T 2: 172,472,635 V15F probably benign Het
Fat3 A G 9: 16,031,368 V1236A possibly damaging Het
Gabbr2 A G 4: 46,718,904 I38T probably damaging Het
Gdpd4 T C 7: 97,966,298 I110T probably damaging Het
Gm4841 C T 18: 60,269,780 A414T possibly damaging Het
Gtf3c4 A T 2: 28,834,770 Y176N probably damaging Het
Hist2h2bb G A 3: 96,269,744 probably null Het
Igsf9b T C 9: 27,319,316 Y264H probably damaging Het
Itih4 A T 14: 30,892,274 N394Y probably damaging Het
Kmt2c T C 5: 25,295,607 T3815A possibly damaging Het
Lrwd1 T C 5: 136,123,400 probably null Het
Mc3r A G 2: 172,249,791 K311R probably benign Het
Myb T C 10: 21,156,360 T41A possibly damaging Het
Nos1 T C 5: 117,947,447 V1280A probably damaging Het
Olfr160 T C 9: 37,711,872 M136V probably benign Het
Olfr586 A C 7: 103,122,575 S66A probably benign Het
Pcdh15 A G 10: 74,342,656 T582A probably damaging Het
Pcdhb12 C A 18: 37,437,322 A507E probably damaging Het
Pdia3 G A 2: 121,432,377 G275S probably damaging Het
Pkp2 C A 16: 16,269,711 A753E probably damaging Het
Plekha3 G A 2: 76,682,798 V76I possibly damaging Het
Pnpla6 T C 8: 3,517,081 L33P probably damaging Het
Pot1b C T 17: 55,666,400 probably benign Het
Prr5l T C 2: 101,758,541 E88G possibly damaging Het
Prss57 G A 10: 79,785,865 H97Y probably damaging Het
Rttn C T 18: 88,973,689 Q131* probably null Het
Scaf11 G T 15: 96,418,295 S1129R possibly damaging Het
Slc25a20 T A 9: 108,681,990 M185K possibly damaging Het
Sorbs3 T A 14: 70,207,572 E19V probably damaging Het
Srgap2 A T 1: 131,289,515 C1020S probably benign Het
Tmem109 T C 19: 10,871,841 R217G possibly damaging Het
Trio A T 15: 27,732,894 I2967N probably damaging Het
Vars2 T C 17: 35,657,299 E899G probably benign Het
Vmn2r109 A G 17: 20,554,580 probably benign Het
Vps53 A G 11: 76,082,659 F170L probably damaging Het
Zc2hc1a G A 3: 7,526,362 S149N possibly damaging Het
Zfp820 A G 17: 21,823,836 probably benign Het
Zhx3 A C 2: 160,780,709 F513V probably damaging Het
Other mutations in Nfix
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Nfix APN 8 84726477 missense probably damaging 0.99
IGL01919:Nfix APN 8 84726474 missense probably damaging 1.00
IGL01950:Nfix APN 8 84713786 makesense probably null
IGL02862:Nfix APN 8 84713846 missense probably benign 0.07
R0142:Nfix UTSW 8 84721686 missense probably damaging 1.00
R0309:Nfix UTSW 8 84721774 missense probably damaging 1.00
R0600:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0622:Nfix UTSW 8 84726482 missense probably damaging 0.99
R0628:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0893:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0973:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0973:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0974:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0975:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1014:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1015:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1162:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1241:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1381:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1513:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1521:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1618:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1865:Nfix UTSW 8 84772275 missense possibly damaging 0.73
R1912:Nfix UTSW 8 84721677 missense probably damaging 1.00
R1974:Nfix UTSW 8 84726526 missense probably damaging 1.00
R2208:Nfix UTSW 8 84716247 frame shift probably null
R2251:Nfix UTSW 8 84716170 missense probably benign 0.03
R2268:Nfix UTSW 8 84716247 frame shift probably null
R2270:Nfix UTSW 8 84716247 frame shift probably null
R2272:Nfix UTSW 8 84727175 missense probably damaging 1.00
R2346:Nfix UTSW 8 84716247 frame shift probably null
R2350:Nfix UTSW 8 84716247 frame shift probably null
R2963:Nfix UTSW 8 84716247 frame shift probably null
R2983:Nfix UTSW 8 84716247 frame shift probably null
R3008:Nfix UTSW 8 84716247 frame shift probably null
R3727:Nfix UTSW 8 84716247 frame shift probably null
R3791:Nfix UTSW 8 84716247 frame shift probably null
R4163:Nfix UTSW 8 84716247 frame shift probably null
R4164:Nfix UTSW 8 84716247 frame shift probably null
R4201:Nfix UTSW 8 84716247 frame shift probably null
R4206:Nfix UTSW 8 84716247 frame shift probably null
R4609:Nfix UTSW 8 84726490 missense probably damaging 1.00
R4801:Nfix UTSW 8 84716247 frame shift probably null
R4802:Nfix UTSW 8 84716247 frame shift probably null
R4914:Nfix UTSW 8 84771829 missense probably benign 0.00
R4915:Nfix UTSW 8 84771829 missense probably benign 0.00
R4916:Nfix UTSW 8 84771829 missense probably benign 0.00
R4918:Nfix UTSW 8 84771829 missense probably benign 0.00
R5013:Nfix UTSW 8 84772084 missense possibly damaging 0.86
R5290:Nfix UTSW 8 84713777 nonsense probably null
R6418:Nfix UTSW 8 84727149 missense probably benign 0.01
R6554:Nfix UTSW 8 84727650 missense possibly damaging 0.93
R6786:Nfix UTSW 8 84727647 missense probably damaging 1.00
T0970:Nfix UTSW 8 84726483 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GCCCTGAGAGGACATCACTTACTCTG -3'
(R):5'- TACGAACTGTGCCCATCACTGC -3'

Sequencing Primer
(F):5'- GAGGACATCACTTACTCTGTGATAC -3'
(R):5'- GCCTGCTTGGTCAGTAGATGTAT -3'
Posted On2013-11-07