Incidental Mutation 'R0883:Mbd5'
ID80709
Institutional Source Beutler Lab
Gene Symbol Mbd5
Ensembl Gene ENSMUSG00000036792
Gene Namemethyl-CpG binding domain protein 5
SynonymsC030040A15Rik, OTTMUSG00000012483, 9430004D19Rik
MMRRC Submission 039050-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0883 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location48949508-49325405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49256689 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 304 (T304A)
Ref Sequence ENSEMBL: ENSMUSP00000108365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047413] [ENSMUST00000112745] [ENSMUST00000112754]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047413
AA Change: T304A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000036847
Gene: ENSMUSG00000036792
AA Change: T304A

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Blast:MBD 24 77 9e-11 BLAST
low complexity region 332 342 N/A INTRINSIC
low complexity region 429 443 N/A INTRINSIC
low complexity region 459 467 N/A INTRINSIC
low complexity region 499 512 N/A INTRINSIC
low complexity region 535 546 N/A INTRINSIC
low complexity region 571 613 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
low complexity region 912 932 N/A INTRINSIC
low complexity region 934 948 N/A INTRINSIC
low complexity region 992 1010 N/A INTRINSIC
low complexity region 1020 1035 N/A INTRINSIC
low complexity region 1112 1136 N/A INTRINSIC
low complexity region 1173 1184 N/A INTRINSIC
low complexity region 1206 1229 N/A INTRINSIC
low complexity region 1552 1562 N/A INTRINSIC
SCOP:d1khca_ 1615 1718 2e-17 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112745
AA Change: T304A

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108365
Gene: ENSMUSG00000036792
AA Change: T304A

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Blast:MBD 24 77 4e-11 BLAST
low complexity region 332 342 N/A INTRINSIC
low complexity region 429 443 N/A INTRINSIC
low complexity region 459 467 N/A INTRINSIC
low complexity region 499 512 N/A INTRINSIC
low complexity region 535 546 N/A INTRINSIC
low complexity region 571 613 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112754
AA Change: T304A

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108374
Gene: ENSMUSG00000036792
AA Change: T304A

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Blast:MBD 24 77 8e-11 BLAST
low complexity region 332 342 N/A INTRINSIC
low complexity region 429 443 N/A INTRINSIC
low complexity region 459 467 N/A INTRINSIC
low complexity region 499 512 N/A INTRINSIC
low complexity region 535 546 N/A INTRINSIC
low complexity region 571 613 N/A INTRINSIC
low complexity region 699 719 N/A INTRINSIC
low complexity region 841 852 N/A INTRINSIC
low complexity region 912 932 N/A INTRINSIC
low complexity region 934 948 N/A INTRINSIC
low complexity region 976 999 N/A INTRINSIC
low complexity region 1322 1332 N/A INTRINSIC
SCOP:d1khca_ 1385 1488 4e-17 SMART
Predicted Effect unknown
Transcript: ENSMUST00000122841
AA Change: T43A
SMART Domains Protein: ENSMUSP00000119317
Gene: ENSMUSG00000036792
AA Change: T43A

DomainStartEndE-ValueType
low complexity region 72 82 N/A INTRINSIC
low complexity region 169 183 N/A INTRINSIC
low complexity region 199 207 N/A INTRINSIC
low complexity region 239 252 N/A INTRINSIC
low complexity region 275 286 N/A INTRINSIC
low complexity region 311 353 N/A INTRINSIC
low complexity region 439 459 N/A INTRINSIC
low complexity region 581 592 N/A INTRINSIC
low complexity region 652 672 N/A INTRINSIC
low complexity region 674 688 N/A INTRINSIC
low complexity region 732 750 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 852 876 N/A INTRINSIC
low complexity region 913 924 N/A INTRINSIC
low complexity region 946 969 N/A INTRINSIC
low complexity region 1011 1022 N/A INTRINSIC
low complexity region 1056 1064 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199257
Meta Mutation Damage Score 0.086 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 98% (148/151)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the methyl-CpG-binding domain (MBD) family. The MBD consists of about 70 residues and is the minimal region required for a methyl-CpG-binding protein binding specifically to methylated DNA. In addition to the MBD domain, this protein contains a PWWP domain (Pro-Trp-Trp-Pro motif), which consists of 100-150 amino acids and is found in numerous proteins that are involved in cell division, growth and differentiation. Mutations in this gene cause mental retardation autosomal dominant type 1. Haploinsufficiency of this gene is associated with a syndrome involving microcephaly, intellectual disabilities, severe speech impairment, and seizures. Alternatively spliced transcript variants have been found, but their full-length nature is not determined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozgyous for a knock-out allele exhibit severe postnatal growth retardation leading to lethality by P22, decreased body, brain and liver weights, reduced IGF-I and GH levels, and abnormal glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 150 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,871 L1607P probably damaging Het
1700016H13Rik T C 5: 103,648,821 *118W probably null Het
1700061G19Rik A T 17: 56,883,835 N468Y probably benign Het
4930595M18Rik G T X: 81,420,931 T390N possibly damaging Het
Abca13 C T 11: 9,291,238 Q1034* probably null Het
Adgra3 T C 5: 49,960,723 H1161R probably damaging Het
AF529169 T C 9: 89,602,417 H309R probably benign Het
Aff1 T C 5: 103,826,138 probably benign Het
Agap2 A G 10: 127,091,702 T1131A possibly damaging Het
Ankrd12 A G 17: 65,985,132 V1102A probably benign Het
Ankrd54 A T 15: 79,062,731 C23S probably damaging Het
Anxa10 C T 8: 62,077,967 V70I probably benign Het
Asap3 T C 4: 136,234,325 probably benign Het
Asb13 T C 13: 3,645,052 probably null Het
Atp6v1a A T 16: 44,101,692 probably benign Het
Atp8b1 T G 18: 64,564,541 I411L probably benign Het
Baiap3 T A 17: 25,249,101 N313I probably damaging Het
Bok T C 1: 93,686,487 I14T probably benign Het
Bri3bp T A 5: 125,441,744 probably null Het
C2cd2l A G 9: 44,316,202 L186P probably damaging Het
Cadm2 A T 16: 66,882,814 C44S probably damaging Het
Capn11 T C 17: 45,638,881 probably benign Het
Carm1 T A 9: 21,569,591 probably benign Het
Ccdc189 T C 7: 127,584,862 E261G probably damaging Het
Ccdc27 T C 4: 154,036,484 E285G unknown Het
Cct3 T A 3: 88,313,557 D298E probably damaging Het
Cd59b T A 2: 104,080,986 probably benign Het
Cdh2 T C 18: 16,629,576 N437S probably benign Het
Celsr3 T A 9: 108,842,633 I2470N probably damaging Het
Cfap100 G A 6: 90,415,906 probably benign Het
Cfap45 A T 1: 172,532,189 R98S possibly damaging Het
Cfap54 T A 10: 92,870,669 H2757L unknown Het
Chd1 C A 17: 15,725,431 N72K probably benign Het
Cntn4 A T 6: 106,667,540 probably benign Het
Cstf2t A T 19: 31,084,626 M521L probably benign Het
Daam2 A T 17: 49,498,883 probably benign Het
Ddias A T 7: 92,859,337 W457R probably benign Het
Ddr2 C T 1: 169,994,629 V417I probably benign Het
Dhx57 T C 17: 80,270,371 T570A probably damaging Het
Dmp1 A G 5: 104,207,630 E32G possibly damaging Het
Dtymk C T 1: 93,801,788 V14M possibly damaging Het
Dync2li1 G A 17: 84,649,271 M286I probably benign Het
Eea1 G A 10: 96,021,667 D664N possibly damaging Het
Esp6 G T 17: 40,565,396 V112L probably benign Het
Fam83h G T 15: 76,006,169 Q127K probably damaging Het
Gabbr2 G A 4: 46,677,474 T802I probably benign Het
Gart C A 16: 91,623,403 D851Y possibly damaging Het
Gemin6 T A 17: 80,228,095 H161Q probably damaging Het
Gm10912 T C 2: 104,066,530 S5P probably benign Het
Gm4907 A T X: 23,907,051 I264F probably benign Het
Gm5941 G A X: 92,490,211 A62T possibly damaging Het
Gng2 G T 14: 19,891,295 D26E probably benign Het
Gpr33 A G 12: 52,023,635 V207A probably benign Het
Gstm3 T A 3: 107,966,270 probably benign Het
Havcr1 T C 11: 46,752,432 C60R probably damaging Het
Hspg2 T C 4: 137,541,440 S2157P probably benign Het
Ift140 A G 17: 25,090,933 T1105A probably benign Het
Igsf8 C A 1: 172,316,259 A56D possibly damaging Het
Kat6a G T 8: 22,862,214 A5S probably damaging Het
Kctd16 A G 18: 40,530,775 E319G probably damaging Het
Kmo T C 1: 175,647,140 V157A possibly damaging Het
Lrp5 T A 19: 3,605,308 I1071F probably damaging Het
Lrrc17 A G 5: 21,561,278 T253A probably benign Het
Mast2 T A 4: 116,311,767 H769L probably damaging Het
Mast4 T C 13: 102,853,900 K50E probably damaging Het
Mbp T C 18: 82,572,870 S73P probably damaging Het
Mc5r T A 18: 68,339,092 V174E probably damaging Het
Med13 T A 11: 86,307,038 T736S probably benign Het
Med13l T C 5: 118,671,002 probably benign Het
Mlh3 C G 12: 85,235,714 A1382P possibly damaging Het
Mpdz T C 4: 81,359,991 probably benign Het
Muc5ac A G 7: 141,796,265 T582A possibly damaging Het
Mum1l1 T A X: 139,235,695 D327E probably damaging Het
Nalcn A G 14: 123,464,740 F453S probably damaging Het
Nrap T A 19: 56,345,474 M902L probably damaging Het
Nup85 C T 11: 115,568,370 R100* probably null Het
Nxf1 T G 19: 8,764,591 N296K probably damaging Het
Ogg1 A G 6: 113,328,420 T65A probably damaging Het
Ogt A G X: 101,644,199 probably benign Het
Olfr1258 A G 2: 89,930,201 T131A probably benign Het
Olfr1298 C T 2: 111,645,791 V69I probably benign Het
Olfr504 T A 7: 108,565,276 N173I probably benign Het
Olfr558 T A 7: 102,709,995 H245Q probably damaging Het
Ovol2 T C 2: 144,331,790 D24G probably damaging Het
Pabpc1 A G 15: 36,599,054 probably benign Het
Pak6 T C 2: 118,693,687 L441P probably damaging Het
Pappa T A 4: 65,189,315 C654* probably null Het
Paqr6 T A 3: 88,365,991 S97T probably damaging Het
Parp14 T C 16: 35,858,518 N360S probably benign Het
Pclo G T 5: 14,677,859 G2244* probably null Het
Pdzrn3 A T 6: 101,155,942 probably null Het
Pes1 T C 11: 3,975,557 M220T probably damaging Het
Phip A T 9: 82,876,221 V1473E probably benign Het
Pkd2l2 T A 18: 34,430,268 probably null Het
Plch1 T C 3: 63,753,256 D302G probably damaging Het
Plekhh2 A G 17: 84,618,031 T1419A probably benign Het
Ppara A T 15: 85,798,171 E356V probably damaging Het
Ppp1r37 G A 7: 19,532,177 P555S probably benign Het
Ppp6r1 T C 7: 4,639,710 E545G possibly damaging Het
Proser3 G A 7: 30,540,699 H327Y probably damaging Het
Prss43 T A 9: 110,829,508 I292N probably damaging Het
Pygl G C 12: 70,206,404 N271K probably damaging Het
Rassf7 T A 7: 141,216,990 probably benign Het
Rfx2 T C 17: 56,803,722 Y88C probably damaging Het
Rpl6 T C 5: 121,208,478 V214A probably benign Het
Rspo1 T A 4: 124,991,432 probably null Het
Sav1 A C 12: 69,966,205 L366V probably benign Het
Sema3b T G 9: 107,604,156 T52P possibly damaging Het
Senp6 A G 9: 80,116,559 D40G probably damaging Het
Sh3pxd2a A G 19: 47,268,207 S719P probably damaging Het
Shank1 C T 7: 44,352,294 R1146W unknown Het
Slc34a3 G T 2: 25,231,233 D307E probably benign Het
Slc35b3 T C 13: 38,937,275 I330V probably benign Het
Slc4a10 G A 2: 62,243,398 C268Y probably benign Het
Slco6d1 A G 1: 98,421,399 E65G probably benign Het
Slit2 A G 5: 48,245,573 probably benign Het
Smcr8 T C 11: 60,778,115 Y30H probably damaging Het
Snap47 A G 11: 59,438,500 probably benign Het
Snrnp25 G A 11: 32,206,960 V15I probably damaging Het
Spns2 T C 11: 72,454,397 Y449C probably damaging Het
Stab2 T A 10: 86,924,450 probably benign Het
Strip1 C A 3: 107,614,613 D750Y probably damaging Het
Taf1c A T 8: 119,599,983 I438N probably damaging Het
Tbc1d2 T A 4: 46,609,003 K745* probably null Het
Tctn1 T C 5: 122,264,144 T76A probably damaging Het
Tfpi T C 2: 84,443,320 probably benign Het
Timm44 A T 8: 4,266,592 H317Q probably benign Het
Tnfaip1 A T 11: 78,530,014 probably benign Het
Tnpo3 A T 6: 29,554,993 probably benign Het
Top3b T C 16: 16,879,437 probably benign Het
Trak1 T A 9: 121,453,285 M410K possibly damaging Het
Trpm3 C A 19: 22,978,654 P1160Q probably damaging Het
Tyk2 T A 9: 21,111,137 T799S possibly damaging Het
Ubfd1 G A 7: 122,067,491 probably benign Het
Unc13a G A 8: 71,642,173 R1272* probably null Het
Unc45b T A 11: 82,940,205 L797Q possibly damaging Het
Urb2 C T 8: 124,030,970 Q1139* probably null Het
Vmn2r66 A T 7: 85,007,862 S112T probably benign Het
Vmn2r71 A T 7: 85,623,634 D552V probably benign Het
Vmn2r76 A G 7: 86,228,696 Y498H probably benign Het
Vmn2r84 A C 10: 130,391,115 W285G probably damaging Het
Vps72 G T 3: 95,122,583 L304F probably damaging Het
Wiz A T 17: 32,356,441 I907N probably damaging Het
Yaf2 T C 15: 93,285,536 K131R probably damaging Het
Zfp141 A T 7: 42,476,056 Y331N possibly damaging Het
Zfp324 G T 7: 12,971,024 C380F probably damaging Het
Zfp521 T C 18: 13,845,062 T765A probably benign Het
Zfp616 A T 11: 74,085,674 H923L probably damaging Het
Zfpm1 C T 8: 122,335,846 T548M probably damaging Het
Zp2 A T 7: 120,143,576 probably benign Het
Other mutations in Mbd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01385:Mbd5 APN 2 49250221 missense possibly damaging 0.92
IGL01481:Mbd5 APN 2 49278939 missense possibly damaging 0.90
IGL01639:Mbd5 APN 2 49272308 missense probably damaging 0.98
IGL02063:Mbd5 APN 2 49274767 missense probably damaging 1.00
IGL02157:Mbd5 APN 2 49278975 missense probably benign
IGL02510:Mbd5 APN 2 49257029 missense probably benign 0.05
IGL02932:Mbd5 APN 2 49279448 missense possibly damaging 0.66
IGL02973:Mbd5 APN 2 49313709 missense probably damaging 0.99
IGL03189:Mbd5 APN 2 49257751 missense probably damaging 0.98
F5770:Mbd5 UTSW 2 49316410 missense probably damaging 0.99
R0391:Mbd5 UTSW 2 49272416 missense possibly damaging 0.90
R0427:Mbd5 UTSW 2 49279079 missense probably benign 0.27
R0544:Mbd5 UTSW 2 49257209 missense possibly damaging 0.54
R1072:Mbd5 UTSW 2 49257191 missense probably damaging 1.00
R1099:Mbd5 UTSW 2 49258144 missense probably benign 0.06
R1400:Mbd5 UTSW 2 49274776 critical splice donor site probably null
R1497:Mbd5 UTSW 2 49257381 missense possibly damaging 0.73
R1552:Mbd5 UTSW 2 49272934 missense probably damaging 0.99
R1675:Mbd5 UTSW 2 49256218 missense possibly damaging 0.90
R1710:Mbd5 UTSW 2 49257032 missense probably benign 0.10
R2085:Mbd5 UTSW 2 49279311 missense possibly damaging 0.90
R2252:Mbd5 UTSW 2 49257686 missense probably damaging 1.00
R2473:Mbd5 UTSW 2 49279341 missense probably benign 0.06
R3966:Mbd5 UTSW 2 49272070 missense possibly damaging 0.46
R4278:Mbd5 UTSW 2 49272293 missense probably damaging 0.97
R4348:Mbd5 UTSW 2 49256327 missense probably benign
R4366:Mbd5 UTSW 2 49272966 missense probably damaging 0.99
R4428:Mbd5 UTSW 2 49279764 missense possibly damaging 0.94
R4556:Mbd5 UTSW 2 49279394 missense probably damaging 1.00
R4600:Mbd5 UTSW 2 49257197 missense probably benign 0.31
R4689:Mbd5 UTSW 2 49258279 missense possibly damaging 0.46
R4707:Mbd5 UTSW 2 49250156 missense probably damaging 0.99
R4718:Mbd5 UTSW 2 49256402 missense possibly damaging 0.66
R4773:Mbd5 UTSW 2 49274611 missense probably damaging 1.00
R4846:Mbd5 UTSW 2 49256997 missense probably damaging 1.00
R5015:Mbd5 UTSW 2 49258196 missense possibly damaging 0.92
R5059:Mbd5 UTSW 2 49256455 missense probably damaging 0.96
R5268:Mbd5 UTSW 2 49272094 missense possibly damaging 0.92
R5479:Mbd5 UTSW 2 49272905 missense probably damaging 0.99
R5579:Mbd5 UTSW 2 49272814 missense possibly damaging 0.94
R5591:Mbd5 UTSW 2 49274669 missense probably damaging 1.00
R5876:Mbd5 UTSW 2 49274645 missense probably damaging 0.98
R5886:Mbd5 UTSW 2 49272452 missense probably damaging 1.00
R5973:Mbd5 UTSW 2 49272389 missense probably benign 0.23
R6935:Mbd5 UTSW 2 49279812 missense probably damaging 0.97
R7317:Mbd5 UTSW 2 49279743 missense probably benign
V7583:Mbd5 UTSW 2 49316410 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGCTCAATCTCTCCAAGGACTGAC -3'
(R):5'- GGCGATGCCTCAATCCTTCCAATTC -3'

Sequencing Primer
(F):5'- CAAGGACTGACCCGCTC -3'
(R):5'- CCAGGTTTTACAGTTGGCAAAG -3'
Posted On2013-11-07