Incidental Mutation 'R0883:Slit2'
ID80764
Institutional Source Beutler Lab
Gene Symbol Slit2
Ensembl Gene ENSMUSG00000031558
Gene Nameslit guidance ligand 2
SynonymsDrad-1, Slil3, E130320P19Rik, E030015M03Rik
MMRRC Submission 039050-MU
Accession Numbers

Ncbi RefSeq: NM_178804.3; MGI: 1315205

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0883 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location47983138-48307733 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 48245573 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033967] [ENSMUST00000170109] [ENSMUST00000172493] [ENSMUST00000173107] [ENSMUST00000174313] [ENSMUST00000174421]
Predicted Effect probably benign
Transcript: ENSMUST00000033967
SMART Domains Protein: ENSMUSP00000033967
Gene: ENSMUSG00000031558

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LRRNT 27 59 6.53e-9 SMART
LRR 53 77 1.41e2 SMART
LRR_TYP 78 101 1.79e-2 SMART
LRR 102 125 2.45e0 SMART
LRR 126 149 9.96e-1 SMART
LRR 154 173 1.29e2 SMART
LRR_TYP 174 197 2.05e-2 SMART
LRRCT 209 258 3.42e-9 SMART
LRRNT 272 304 4.55e-8 SMART
LRR 298 322 3e1 SMART
LRR_TYP 323 346 1.95e-3 SMART
LRR_TYP 347 370 2.24e-3 SMART
LRR 371 394 1.31e0 SMART
LRR 395 418 2.49e-1 SMART
LRRCT 430 479 1.88e-6 SMART
LRRNT 497 529 1.45e-6 SMART
LRR_TYP 549 572 1.38e-3 SMART
LRR 597 620 9.96e-1 SMART
LRR_TYP 621 644 2.71e-2 SMART
LRRCT 656 705 3.56e-7 SMART
LRRNT 718 750 3.69e-8 SMART
LRR 768 791 7.36e0 SMART
LRR_TYP 792 815 5.59e-4 SMART
LRR_TYP 816 839 7.9e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170109
SMART Domains Protein: ENSMUSP00000127615
Gene: ENSMUSG00000031558

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LRRNT 27 59 6.53e-9 SMART
LRR 53 77 1.41e2 SMART
LRR_TYP 78 101 1.79e-2 SMART
LRR 102 125 2.45e0 SMART
LRR 126 149 9.96e-1 SMART
LRR 154 173 1.29e2 SMART
LRR_TYP 174 197 2.05e-2 SMART
LRRCT 209 258 3.42e-9 SMART
LRRNT 272 304 4.55e-8 SMART
LRR 298 322 3e1 SMART
LRR_TYP 323 346 1.95e-3 SMART
LRR_TYP 347 370 2.24e-3 SMART
LRR 371 394 1.31e0 SMART
LRR 395 418 2.49e-1 SMART
LRRCT 430 479 1.88e-6 SMART
LRRNT 497 529 1.45e-6 SMART
LRR_TYP 549 572 1.38e-3 SMART
LRR 597 620 9.96e-1 SMART
LRR_TYP 621 644 2.71e-2 SMART
LRRCT 656 705 3.56e-7 SMART
LRRNT 718 750 3.69e-8 SMART
LRR 768 791 7.36e0 SMART
LRR_TYP 792 815 5.59e-4 SMART
LRR_TYP 816 839 7.9e-4 SMART
LRRCT 851 900 3.9e-13 SMART
EGF 913 947 3.73e-5 SMART
EGF 952 988 4.35e-6 SMART
EGF_CA 990 1026 2.21e-7 SMART
FOLN 993 1015 5.84e1 SMART
EGF 1031 1066 1.07e-5 SMART
EGF_CA 1068 1104 3.97e-9 SMART
FOLN 1116 1138 2.22e0 SMART
EGF 1116 1149 1.62e-5 SMART
LamG 1172 1308 4.82e-39 SMART
EGF 1327 1360 3.68e-4 SMART
EGF 1366 1399 3.88e-3 SMART
FOLN 1407 1429 3.34e0 SMART
EGF 1407 1440 4.46e-3 SMART
CT 1451 1520 4.23e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172484
Predicted Effect probably benign
Transcript: ENSMUST00000172493
SMART Domains Protein: ENSMUSP00000134655
Gene: ENSMUSG00000031558

DomainStartEndE-ValueType
LRR 20 43 3.1e-2 SMART
LRR_TYP 44 67 2.4e-6 SMART
LRR_TYP 68 91 3.2e-6 SMART
LRRCT 103 152 1.8e-15 SMART
EGF 176 210 1.8e-7 SMART
EGF 215 251 2.1e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173107
SMART Domains Protein: ENSMUSP00000133840
Gene: ENSMUSG00000031558

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LRRNT 27 59 6.53e-9 SMART
LRR 53 77 1.41e2 SMART
LRR_TYP 78 101 1.79e-2 SMART
LRR 102 125 2.45e0 SMART
LRR 126 149 9.96e-1 SMART
LRR 154 173 1.29e2 SMART
LRR_TYP 174 197 2.05e-2 SMART
LRRCT 209 258 3.42e-9 SMART
LRRNT 272 304 4.55e-8 SMART
LRR 298 322 3e1 SMART
LRR_TYP 323 346 1.95e-3 SMART
LRR_TYP 347 370 2.24e-3 SMART
LRR 371 394 1.31e0 SMART
LRR 395 418 2.49e-1 SMART
LRRCT 430 479 1.88e-6 SMART
LRRNT 505 537 1.45e-6 SMART
LRR_TYP 557 580 1.38e-3 SMART
LRR 605 628 9.96e-1 SMART
LRR_TYP 629 652 2.71e-2 SMART
LRRCT 664 713 3.56e-7 SMART
LRRNT 726 758 3.69e-8 SMART
LRR 776 799 7.36e0 SMART
LRR_TYP 800 823 5.59e-4 SMART
LRR_TYP 824 847 7.9e-4 SMART
LRRCT 859 908 3.9e-13 SMART
EGF 921 955 3.73e-5 SMART
EGF 960 996 4.35e-6 SMART
EGF_CA 998 1034 2.21e-7 SMART
FOLN 1001 1023 5.84e1 SMART
EGF 1039 1074 1.07e-5 SMART
EGF_CA 1076 1112 3.97e-9 SMART
FOLN 1124 1146 2.22e0 SMART
EGF 1124 1157 1.62e-5 SMART
LamG 1180 1316 4.82e-39 SMART
EGF 1335 1368 3.68e-4 SMART
EGF 1374 1407 3.88e-3 SMART
FOLN 1415 1437 3.34e0 SMART
EGF 1415 1448 4.46e-3 SMART
CT 1459 1528 4.23e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173671
Predicted Effect probably benign
Transcript: ENSMUST00000174313
SMART Domains Protein: ENSMUSP00000133912
Gene: ENSMUSG00000031558

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LRRNT 27 59 6.53e-9 SMART
LRR 53 77 1.41e2 SMART
LRR_TYP 78 101 1.79e-2 SMART
LRR 102 125 2.45e0 SMART
LRR 126 149 9.96e-1 SMART
LRR 154 173 1.29e2 SMART
LRR_TYP 174 197 2.05e-2 SMART
LRRCT 209 258 3.42e-9 SMART
LRRNT 276 308 4.55e-8 SMART
LRR 302 326 3e1 SMART
LRR_TYP 327 350 1.95e-3 SMART
LRR_TYP 351 374 2.24e-3 SMART
LRR 375 398 1.31e0 SMART
LRR 399 422 2.49e-1 SMART
LRRCT 434 483 1.88e-6 SMART
LRRNT 501 533 1.45e-6 SMART
LRR_TYP 553 576 1.38e-3 SMART
LRR 601 624 9.96e-1 SMART
LRR_TYP 625 648 2.71e-2 SMART
LRRCT 660 709 3.56e-7 SMART
LRRNT 722 754 3.69e-8 SMART
LRR 772 795 7.36e0 SMART
LRR_TYP 796 819 5.59e-4 SMART
LRR_TYP 820 843 7.9e-4 SMART
LRRCT 855 904 3.9e-13 SMART
EGF 917 951 3.73e-5 SMART
EGF 956 992 4.35e-6 SMART
EGF_CA 994 1030 2.21e-7 SMART
FOLN 997 1019 5.84e1 SMART
EGF 1035 1070 1.07e-5 SMART
EGF_CA 1072 1108 3.97e-9 SMART
FOLN 1120 1142 2.22e0 SMART
EGF 1120 1153 1.62e-5 SMART
LamG 1176 1312 4.82e-39 SMART
EGF 1331 1364 3.68e-4 SMART
EGF 1370 1403 3.88e-3 SMART
FOLN 1411 1433 3.34e0 SMART
EGF 1411 1444 4.46e-3 SMART
CT 1455 1524 4.23e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174421
SMART Domains Protein: ENSMUSP00000134263
Gene: ENSMUSG00000031558

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
LRRNT 27 59 6.53e-9 SMART
LRR 53 77 1.41e2 SMART
LRR_TYP 78 101 1.79e-2 SMART
LRR 102 125 2.45e0 SMART
LRR 126 149 9.96e-1 SMART
LRR 154 173 1.29e2 SMART
LRR_TYP 174 197 2.05e-2 SMART
LRRCT 209 258 3.42e-9 SMART
LRRNT 276 308 4.55e-8 SMART
LRR 302 326 3e1 SMART
LRR_TYP 327 350 1.95e-3 SMART
LRR_TYP 351 374 2.24e-3 SMART
LRR 375 398 1.31e0 SMART
LRR 399 422 2.49e-1 SMART
LRRCT 434 483 1.88e-6 SMART
LRRNT 509 541 1.45e-6 SMART
LRR_TYP 561 584 1.38e-3 SMART
LRR 609 632 9.96e-1 SMART
LRR_TYP 633 656 2.71e-2 SMART
LRRCT 668 717 3.56e-7 SMART
LRRNT 730 762 3.69e-8 SMART
LRR 780 803 7.36e0 SMART
LRR_TYP 804 827 5.59e-4 SMART
LRR_TYP 828 851 7.9e-4 SMART
LRRCT 863 912 3.9e-13 SMART
EGF 925 959 3.73e-5 SMART
EGF 964 1000 4.35e-6 SMART
EGF_CA 1002 1047 4.74e-7 SMART
FOLN 1005 1027 5.84e1 SMART
EGF 1052 1087 1.07e-5 SMART
EGF_CA 1089 1125 3.97e-9 SMART
FOLN 1137 1159 2.22e0 SMART
EGF 1137 1170 1.62e-5 SMART
LamG 1193 1329 4.82e-39 SMART
EGF 1348 1381 3.68e-4 SMART
EGF 1387 1420 3.88e-3 SMART
FOLN 1428 1450 3.34e0 SMART
EGF 1428 1461 4.46e-3 SMART
CT 1472 1541 4.23e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199024
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 98% (148/151)
MGI Phenotype Strain: 2179460
FUNCTION: The protein encoded by this gene is a member of the Slit family of secreted glycoproteins, which function as ligands for the Robo family of immunoglobulin receptors. Slit proteins play highly conserved roles in axon guidance and neuronal migration and may also have functions during other cell migration processes including leukocyte migration. In mammals, members of the slit family are characterized by an N-terminal signal peptide, four leucine-rich repeats, nine epidermal growth factor repeats, and a C-terminal cysteine knot. Mice deficient for this gene exhibit abnormal axonal projections in the embryonic forebrain and develop supernumerary uretic buds that maintain improper connections to the nephric duct. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous mutants display perinatal lethality, abnormal ureteric bud development, multiple fused kidneys, multiple ureters, and hydroureter. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 150 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,871 L1607P probably damaging Het
1700016H13Rik T C 5: 103,648,821 *118W probably null Het
1700061G19Rik A T 17: 56,883,835 N468Y probably benign Het
4930595M18Rik G T X: 81,420,931 T390N possibly damaging Het
Abca13 C T 11: 9,291,238 Q1034* probably null Het
Adgra3 T C 5: 49,960,723 H1161R probably damaging Het
AF529169 T C 9: 89,602,417 H309R probably benign Het
Aff1 T C 5: 103,826,138 probably benign Het
Agap2 A G 10: 127,091,702 T1131A possibly damaging Het
Ankrd12 A G 17: 65,985,132 V1102A probably benign Het
Ankrd54 A T 15: 79,062,731 C23S probably damaging Het
Anxa10 C T 8: 62,077,967 V70I probably benign Het
Asap3 T C 4: 136,234,325 probably benign Het
Asb13 T C 13: 3,645,052 probably null Het
Atp6v1a A T 16: 44,101,692 probably benign Het
Atp8b1 T G 18: 64,564,541 I411L probably benign Het
Baiap3 T A 17: 25,249,101 N313I probably damaging Het
Bok T C 1: 93,686,487 I14T probably benign Het
Bri3bp T A 5: 125,441,744 probably null Het
C2cd2l A G 9: 44,316,202 L186P probably damaging Het
Cadm2 A T 16: 66,882,814 C44S probably damaging Het
Capn11 T C 17: 45,638,881 probably benign Het
Carm1 T A 9: 21,569,591 probably benign Het
Ccdc189 T C 7: 127,584,862 E261G probably damaging Het
Ccdc27 T C 4: 154,036,484 E285G unknown Het
Cct3 T A 3: 88,313,557 D298E probably damaging Het
Cd59b T A 2: 104,080,986 probably benign Het
Cdh2 T C 18: 16,629,576 N437S probably benign Het
Celsr3 T A 9: 108,842,633 I2470N probably damaging Het
Cfap100 G A 6: 90,415,906 probably benign Het
Cfap45 A T 1: 172,532,189 R98S possibly damaging Het
Cfap54 T A 10: 92,870,669 H2757L unknown Het
Chd1 C A 17: 15,725,431 N72K probably benign Het
Cntn4 A T 6: 106,667,540 probably benign Het
Cstf2t A T 19: 31,084,626 M521L probably benign Het
Daam2 A T 17: 49,498,883 probably benign Het
Ddias A T 7: 92,859,337 W457R probably benign Het
Ddr2 C T 1: 169,994,629 V417I probably benign Het
Dhx57 T C 17: 80,270,371 T570A probably damaging Het
Dmp1 A G 5: 104,207,630 E32G possibly damaging Het
Dtymk C T 1: 93,801,788 V14M possibly damaging Het
Dync2li1 G A 17: 84,649,271 M286I probably benign Het
Eea1 G A 10: 96,021,667 D664N possibly damaging Het
Esp6 G T 17: 40,565,396 V112L probably benign Het
Fam83h G T 15: 76,006,169 Q127K probably damaging Het
Gabbr2 G A 4: 46,677,474 T802I probably benign Het
Gart C A 16: 91,623,403 D851Y possibly damaging Het
Gemin6 T A 17: 80,228,095 H161Q probably damaging Het
Gm10912 T C 2: 104,066,530 S5P probably benign Het
Gm4907 A T X: 23,907,051 I264F probably benign Het
Gm5941 G A X: 92,490,211 A62T possibly damaging Het
Gng2 G T 14: 19,891,295 D26E probably benign Het
Gpr33 A G 12: 52,023,635 V207A probably benign Het
Gstm3 T A 3: 107,966,270 probably benign Het
Havcr1 T C 11: 46,752,432 C60R probably damaging Het
Hspg2 T C 4: 137,541,440 S2157P probably benign Het
Ift140 A G 17: 25,090,933 T1105A probably benign Het
Igsf8 C A 1: 172,316,259 A56D possibly damaging Het
Kat6a G T 8: 22,862,214 A5S probably damaging Het
Kctd16 A G 18: 40,530,775 E319G probably damaging Het
Kmo T C 1: 175,647,140 V157A possibly damaging Het
Lrp5 T A 19: 3,605,308 I1071F probably damaging Het
Lrrc17 A G 5: 21,561,278 T253A probably benign Het
Mast2 T A 4: 116,311,767 H769L probably damaging Het
Mast4 T C 13: 102,853,900 K50E probably damaging Het
Mbd5 A G 2: 49,256,689 T304A possibly damaging Het
Mbp T C 18: 82,572,870 S73P probably damaging Het
Mc5r T A 18: 68,339,092 V174E probably damaging Het
Med13 T A 11: 86,307,038 T736S probably benign Het
Med13l T C 5: 118,671,002 probably benign Het
Mlh3 C G 12: 85,235,714 A1382P possibly damaging Het
Mpdz T C 4: 81,359,991 probably benign Het
Muc5ac A G 7: 141,796,265 T582A possibly damaging Het
Mum1l1 T A X: 139,235,695 D327E probably damaging Het
Nalcn A G 14: 123,464,740 F453S probably damaging Het
Nrap T A 19: 56,345,474 M902L probably damaging Het
Nup85 C T 11: 115,568,370 R100* probably null Het
Nxf1 T G 19: 8,764,591 N296K probably damaging Het
Ogg1 A G 6: 113,328,420 T65A probably damaging Het
Ogt A G X: 101,644,199 probably benign Het
Olfr1258 A G 2: 89,930,201 T131A probably benign Het
Olfr1298 C T 2: 111,645,791 V69I probably benign Het
Olfr504 T A 7: 108,565,276 N173I probably benign Het
Olfr558 T A 7: 102,709,995 H245Q probably damaging Het
Ovol2 T C 2: 144,331,790 D24G probably damaging Het
Pabpc1 A G 15: 36,599,054 probably benign Het
Pak6 T C 2: 118,693,687 L441P probably damaging Het
Pappa T A 4: 65,189,315 C654* probably null Het
Paqr6 T A 3: 88,365,991 S97T probably damaging Het
Parp14 T C 16: 35,858,518 N360S probably benign Het
Pclo G T 5: 14,677,859 G2244* probably null Het
Pdzrn3 A T 6: 101,155,942 probably null Het
Pes1 T C 11: 3,975,557 M220T probably damaging Het
Phip A T 9: 82,876,221 V1473E probably benign Het
Pkd2l2 T A 18: 34,430,268 probably null Het
Plch1 T C 3: 63,753,256 D302G probably damaging Het
Plekhh2 A G 17: 84,618,031 T1419A probably benign Het
Ppara A T 15: 85,798,171 E356V probably damaging Het
Ppp1r37 G A 7: 19,532,177 P555S probably benign Het
Ppp6r1 T C 7: 4,639,710 E545G possibly damaging Het
Proser3 G A 7: 30,540,699 H327Y probably damaging Het
Prss43 T A 9: 110,829,508 I292N probably damaging Het
Pygl G C 12: 70,206,404 N271K probably damaging Het
Rassf7 T A 7: 141,216,990 probably benign Het
Rfx2 T C 17: 56,803,722 Y88C probably damaging Het
Rpl6 T C 5: 121,208,478 V214A probably benign Het
Rspo1 T A 4: 124,991,432 probably null Het
Sav1 A C 12: 69,966,205 L366V probably benign Het
Sema3b T G 9: 107,604,156 T52P possibly damaging Het
Senp6 A G 9: 80,116,559 D40G probably damaging Het
Sh3pxd2a A G 19: 47,268,207 S719P probably damaging Het
Shank1 C T 7: 44,352,294 R1146W unknown Het
Slc34a3 G T 2: 25,231,233 D307E probably benign Het
Slc35b3 T C 13: 38,937,275 I330V probably benign Het
Slc4a10 G A 2: 62,243,398 C268Y probably benign Het
Slco6d1 A G 1: 98,421,399 E65G probably benign Het
Smcr8 T C 11: 60,778,115 Y30H probably damaging Het
Snap47 A G 11: 59,438,500 probably benign Het
Snrnp25 G A 11: 32,206,960 V15I probably damaging Het
Spns2 T C 11: 72,454,397 Y449C probably damaging Het
Stab2 T A 10: 86,924,450 probably benign Het
Strip1 C A 3: 107,614,613 D750Y probably damaging Het
Taf1c A T 8: 119,599,983 I438N probably damaging Het
Tbc1d2 T A 4: 46,609,003 K745* probably null Het
Tctn1 T C 5: 122,264,144 T76A probably damaging Het
Tfpi T C 2: 84,443,320 probably benign Het
Timm44 A T 8: 4,266,592 H317Q probably benign Het
Tnfaip1 A T 11: 78,530,014 probably benign Het
Tnpo3 A T 6: 29,554,993 probably benign Het
Top3b T C 16: 16,879,437 probably benign Het
Trak1 T A 9: 121,453,285 M410K possibly damaging Het
Trpm3 C A 19: 22,978,654 P1160Q probably damaging Het
Tyk2 T A 9: 21,111,137 T799S possibly damaging Het
Ubfd1 G A 7: 122,067,491 probably benign Het
Unc13a G A 8: 71,642,173 R1272* probably null Het
Unc45b T A 11: 82,940,205 L797Q possibly damaging Het
Urb2 C T 8: 124,030,970 Q1139* probably null Het
Vmn2r66 A T 7: 85,007,862 S112T probably benign Het
Vmn2r71 A T 7: 85,623,634 D552V probably benign Het
Vmn2r76 A G 7: 86,228,696 Y498H probably benign Het
Vmn2r84 A C 10: 130,391,115 W285G probably damaging Het
Vps72 G T 3: 95,122,583 L304F probably damaging Het
Wiz A T 17: 32,356,441 I907N probably damaging Het
Yaf2 T C 15: 93,285,536 K131R probably damaging Het
Zfp141 A T 7: 42,476,056 Y331N possibly damaging Het
Zfp324 G T 7: 12,971,024 C380F probably damaging Het
Zfp521 T C 18: 13,845,062 T765A probably benign Het
Zfp616 A T 11: 74,085,674 H923L probably damaging Het
Zfpm1 C T 8: 122,335,846 T548M probably damaging Het
Zp2 A T 7: 120,143,576 probably benign Het
Other mutations in Slit2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00791:Slit2 APN 5 48304032 missense possibly damaging 0.86
IGL00809:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00811:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00813:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00815:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00816:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00817:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00819:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00820:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL00822:Slit2 APN 5 47989151 missense possibly damaging 0.88
IGL01077:Slit2 APN 5 48217443 splice site probably null
IGL01375:Slit2 APN 5 48281714 splice site probably benign
IGL01481:Slit2 APN 5 48302931 missense probably benign 0.05
IGL01934:Slit2 APN 5 48238405 missense possibly damaging 0.93
IGL01992:Slit2 APN 5 48238417 missense probably benign 0.01
IGL02315:Slit2 APN 5 47987871 missense probably damaging 0.98
IGL02328:Slit2 APN 5 48230304 missense probably damaging 1.00
IGL02366:Slit2 APN 5 48304068 missense possibly damaging 0.53
IGL02526:Slit2 APN 5 48304223 nonsense probably null
IGL02852:Slit2 APN 5 48244672 missense probably damaging 1.00
IGL02887:Slit2 APN 5 48217474 missense probably benign 0.44
IGL03123:Slit2 APN 5 48211339 missense probably damaging 1.00
IGL03182:Slit2 APN 5 48220053 missense possibly damaging 0.77
P0025:Slit2 UTSW 5 48304035 missense probably damaging 0.96
R0032:Slit2 UTSW 5 48256856 missense probably damaging 0.99
R0032:Slit2 UTSW 5 48256856 missense probably damaging 0.99
R0055:Slit2 UTSW 5 48281726 nonsense probably null
R0055:Slit2 UTSW 5 48281726 nonsense probably null
R0267:Slit2 UTSW 5 48182331 splice site probably benign
R0552:Slit2 UTSW 5 48238379 missense probably damaging 1.00
R0610:Slit2 UTSW 5 48275674 missense possibly damaging 0.77
R1390:Slit2 UTSW 5 48217490 missense probably benign 0.06
R1442:Slit2 UTSW 5 48238383 missense probably damaging 0.96
R1453:Slit2 UTSW 5 48257051 missense possibly damaging 0.88
R1508:Slit2 UTSW 5 48192249 missense probably damaging 0.98
R1639:Slit2 UTSW 5 48259654 missense probably damaging 1.00
R1705:Slit2 UTSW 5 48189472 missense probably damaging 0.99
R1828:Slit2 UTSW 5 48304030 missense probably damaging 1.00
R1897:Slit2 UTSW 5 48238423 missense probably damaging 1.00
R1908:Slit2 UTSW 5 48281988 missense probably damaging 1.00
R1919:Slit2 UTSW 5 48191016 unclassified probably benign
R1982:Slit2 UTSW 5 48249836 missense probably damaging 1.00
R2013:Slit2 UTSW 5 48302490 missense probably damaging 1.00
R2136:Slit2 UTSW 5 48304225 missense probably benign 0.03
R2655:Slit2 UTSW 5 48189575 missense possibly damaging 0.88
R3402:Slit2 UTSW 5 48283421 missense probably damaging 0.98
R3724:Slit2 UTSW 5 48256883 critical splice donor site probably null
R4176:Slit2 UTSW 5 48237244 splice site probably null
R4306:Slit2 UTSW 5 48302783 missense possibly damaging 0.83
R4397:Slit2 UTSW 5 48220081 critical splice donor site probably null
R4525:Slit2 UTSW 5 48249873 missense probably damaging 1.00
R4688:Slit2 UTSW 5 48257003 splice site probably null
R5026:Slit2 UTSW 5 48256805 missense probably damaging 0.99
R5138:Slit2 UTSW 5 48281967 missense probably damaging 1.00
R5465:Slit2 UTSW 5 48249912 missense probably damaging 1.00
R5471:Slit2 UTSW 5 48189555 missense probably damaging 1.00
R5699:Slit2 UTSW 5 48220991 critical splice donor site probably null
R5735:Slit2 UTSW 5 48259616 missense probably damaging 1.00
R5834:Slit2 UTSW 5 48259647 missense probably damaging 1.00
R5967:Slit2 UTSW 5 47985164 missense probably damaging 0.99
R6150:Slit2 UTSW 5 48304174 missense probably damaging 1.00
R6219:Slit2 UTSW 5 48302428 missense possibly damaging 0.53
R6344:Slit2 UTSW 5 48219681 missense probably benign 0.07
R6408:Slit2 UTSW 5 47984986 unclassified probably benign
R6479:Slit2 UTSW 5 48231989 missense probably damaging 1.00
R6526:Slit2 UTSW 5 48304167 missense probably damaging 0.99
R6959:Slit2 UTSW 5 48238385 missense possibly damaging 0.83
R7139:Slit2 UTSW 5 48244683 missense probably benign 0.19
R7201:Slit2 UTSW 5 48237285 missense probably null 0.85
Z1088:Slit2 UTSW 5 48302353 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAGTCAGAGGATGAATGAGGCA -3'
(R):5'- TTGAGAAACAGCTACACACGGTAAAAGA -3'

Sequencing Primer
(F):5'- GAATGAGGCATGTGTACACAGT -3'
(R):5'- CAGTAACATGTATTACACAAGAGCAG -3'
Posted On2013-11-07