Incidental Mutation 'R0883:Shank1'
ID80803
Institutional Source Beutler Lab
Gene Symbol Shank1
Ensembl Gene ENSMUSG00000038738
Gene NameSH3 and multiple ankyrin repeat domains 1
Synonyms
MMRRC Submission 039050-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.338) question?
Stock #R0883 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44310253-44360572 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44352294 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 1146 (R1146W)
Ref Sequence ENSEMBL: ENSMUSP00000103571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107934] [ENSMUST00000107935] [ENSMUST00000107938]
Predicted Effect unknown
Transcript: ENSMUST00000107934
AA Change: R1137W
SMART Domains Protein: ENSMUSP00000103567
Gene: ENSMUSG00000038738
AA Change: R1137W

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
ANK 212 242 5.75e-1 SMART
ANK 246 275 3.6e-2 SMART
ANK 279 309 3.44e1 SMART
ANK 313 342 1.97e1 SMART
ANK 346 375 3.97e-4 SMART
ANK 379 407 5.69e2 SMART
low complexity region 452 479 N/A INTRINSIC
low complexity region 487 504 N/A INTRINSIC
low complexity region 521 548 N/A INTRINSIC
SH3 557 612 3.73e-16 SMART
PDZ 663 752 2.12e-13 SMART
Blast:PDZ 795 830 5e-11 BLAST
low complexity region 920 941 N/A INTRINSIC
low complexity region 955 982 N/A INTRINSIC
low complexity region 993 1023 N/A INTRINSIC
low complexity region 1051 1080 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1162 1175 N/A INTRINSIC
low complexity region 1179 1220 N/A INTRINSIC
low complexity region 1256 1275 N/A INTRINSIC
low complexity region 1298 1323 N/A INTRINSIC
low complexity region 1348 1359 N/A INTRINSIC
low complexity region 1369 1404 N/A INTRINSIC
low complexity region 1450 1466 N/A INTRINSIC
low complexity region 1512 1532 N/A INTRINSIC
low complexity region 1539 1555 N/A INTRINSIC
low complexity region 1557 1570 N/A INTRINSIC
low complexity region 1580 1614 N/A INTRINSIC
low complexity region 1633 1667 N/A INTRINSIC
low complexity region 1685 1720 N/A INTRINSIC
low complexity region 1735 1746 N/A INTRINSIC
low complexity region 1776 1787 N/A INTRINSIC
low complexity region 1806 1823 N/A INTRINSIC
low complexity region 1834 1852 N/A INTRINSIC
low complexity region 1893 1907 N/A INTRINSIC
low complexity region 1925 1936 N/A INTRINSIC
low complexity region 1942 1976 N/A INTRINSIC
low complexity region 1988 2004 N/A INTRINSIC
low complexity region 2009 2029 N/A INTRINSIC
low complexity region 2059 2083 N/A INTRINSIC
SAM 2092 2158 1.35e-14 SMART
Predicted Effect unknown
Transcript: ENSMUST00000107935
AA Change: R1138W
SMART Domains Protein: ENSMUSP00000103568
Gene: ENSMUSG00000038738
AA Change: R1138W

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
ANK 212 242 5.75e-1 SMART
ANK 246 275 3.6e-2 SMART
ANK 279 309 3.44e1 SMART
ANK 313 342 1.97e1 SMART
ANK 346 375 3.97e-4 SMART
ANK 379 407 5.69e2 SMART
low complexity region 452 479 N/A INTRINSIC
low complexity region 487 504 N/A INTRINSIC
low complexity region 521 548 N/A INTRINSIC
SH3 557 612 3.73e-16 SMART
low complexity region 648 659 N/A INTRINSIC
PDZ 672 761 2.12e-13 SMART
Blast:PDZ 796 831 1e-10 BLAST
low complexity region 921 942 N/A INTRINSIC
low complexity region 956 983 N/A INTRINSIC
low complexity region 994 1024 N/A INTRINSIC
low complexity region 1052 1081 N/A INTRINSIC
low complexity region 1124 1139 N/A INTRINSIC
low complexity region 1163 1176 N/A INTRINSIC
low complexity region 1180 1221 N/A INTRINSIC
low complexity region 1257 1276 N/A INTRINSIC
low complexity region 1299 1324 N/A INTRINSIC
low complexity region 1349 1360 N/A INTRINSIC
low complexity region 1370 1405 N/A INTRINSIC
low complexity region 1451 1467 N/A INTRINSIC
low complexity region 1513 1533 N/A INTRINSIC
low complexity region 1540 1556 N/A INTRINSIC
low complexity region 1558 1571 N/A INTRINSIC
low complexity region 1581 1615 N/A INTRINSIC
low complexity region 1634 1668 N/A INTRINSIC
low complexity region 1686 1721 N/A INTRINSIC
low complexity region 1736 1747 N/A INTRINSIC
low complexity region 1777 1788 N/A INTRINSIC
low complexity region 1807 1824 N/A INTRINSIC
low complexity region 1835 1853 N/A INTRINSIC
low complexity region 1894 1908 N/A INTRINSIC
low complexity region 1926 1937 N/A INTRINSIC
low complexity region 1943 1977 N/A INTRINSIC
low complexity region 1989 2005 N/A INTRINSIC
low complexity region 2010 2030 N/A INTRINSIC
low complexity region 2060 2084 N/A INTRINSIC
SAM 2093 2159 1.35e-14 SMART
Predicted Effect unknown
Transcript: ENSMUST00000107938
AA Change: R1146W
SMART Domains Protein: ENSMUSP00000103571
Gene: ENSMUSG00000038738
AA Change: R1146W

DomainStartEndE-ValueType
low complexity region 17 46 N/A INTRINSIC
Pfam:FERM_f0 73 156 6.6e-17 PFAM
ANK 212 242 5.75e-1 SMART
ANK 246 275 3.6e-2 SMART
ANK 279 309 3.44e1 SMART
ANK 313 342 1.97e1 SMART
ANK 346 375 3.97e-4 SMART
ANK 379 407 5.69e2 SMART
low complexity region 452 479 N/A INTRINSIC
low complexity region 487 504 N/A INTRINSIC
low complexity region 521 548 N/A INTRINSIC
SH3 557 612 3.73e-16 SMART
low complexity region 648 659 N/A INTRINSIC
PDZ 672 761 2.12e-13 SMART
Blast:PDZ 804 839 5e-11 BLAST
low complexity region 929 950 N/A INTRINSIC
low complexity region 964 991 N/A INTRINSIC
low complexity region 1002 1032 N/A INTRINSIC
low complexity region 1060 1089 N/A INTRINSIC
low complexity region 1132 1147 N/A INTRINSIC
low complexity region 1171 1184 N/A INTRINSIC
low complexity region 1188 1229 N/A INTRINSIC
low complexity region 1265 1284 N/A INTRINSIC
low complexity region 1307 1332 N/A INTRINSIC
low complexity region 1357 1368 N/A INTRINSIC
low complexity region 1378 1413 N/A INTRINSIC
low complexity region 1459 1475 N/A INTRINSIC
low complexity region 1521 1541 N/A INTRINSIC
low complexity region 1548 1564 N/A INTRINSIC
low complexity region 1566 1579 N/A INTRINSIC
low complexity region 1589 1623 N/A INTRINSIC
low complexity region 1642 1676 N/A INTRINSIC
low complexity region 1694 1729 N/A INTRINSIC
low complexity region 1744 1755 N/A INTRINSIC
low complexity region 1785 1796 N/A INTRINSIC
low complexity region 1815 1832 N/A INTRINSIC
low complexity region 1843 1861 N/A INTRINSIC
low complexity region 1902 1916 N/A INTRINSIC
low complexity region 1934 1945 N/A INTRINSIC
low complexity region 1951 1985 N/A INTRINSIC
low complexity region 1997 2013 N/A INTRINSIC
low complexity region 2018 2038 N/A INTRINSIC
low complexity region 2068 2092 N/A INTRINSIC
SAM 2101 2167 1.35e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154776
Meta Mutation Damage Score 0.104 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 98% (148/151)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SHANK (SH3 domain and ankyrin repeat containing) family of proteins. Members of this family act as scaffold proteins that are required for the development and function of neuronal synapses. Deletions in this gene may be associated with autism spectrum disorder in males. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous mutation of this gene results in smaller pyramidal neuron dendritic spines, smaller and thinner postsynaptic density of central excitatory synapses, weaker synaptic transmission, increased anxiety-related behavior, and impaired contextual fearmemory, but enhanced spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 150 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,871 L1607P probably damaging Het
1700016H13Rik T C 5: 103,648,821 *118W probably null Het
1700061G19Rik A T 17: 56,883,835 N468Y probably benign Het
4930595M18Rik G T X: 81,420,931 T390N possibly damaging Het
Abca13 C T 11: 9,291,238 Q1034* probably null Het
Adgra3 T C 5: 49,960,723 H1161R probably damaging Het
AF529169 T C 9: 89,602,417 H309R probably benign Het
Aff1 T C 5: 103,826,138 probably benign Het
Agap2 A G 10: 127,091,702 T1131A possibly damaging Het
Ankrd12 A G 17: 65,985,132 V1102A probably benign Het
Ankrd54 A T 15: 79,062,731 C23S probably damaging Het
Anxa10 C T 8: 62,077,967 V70I probably benign Het
Asap3 T C 4: 136,234,325 probably benign Het
Asb13 T C 13: 3,645,052 probably null Het
Atp6v1a A T 16: 44,101,692 probably benign Het
Atp8b1 T G 18: 64,564,541 I411L probably benign Het
Baiap3 T A 17: 25,249,101 N313I probably damaging Het
Bok T C 1: 93,686,487 I14T probably benign Het
Bri3bp T A 5: 125,441,744 probably null Het
C2cd2l A G 9: 44,316,202 L186P probably damaging Het
Cadm2 A T 16: 66,882,814 C44S probably damaging Het
Capn11 T C 17: 45,638,881 probably benign Het
Carm1 T A 9: 21,569,591 probably benign Het
Ccdc189 T C 7: 127,584,862 E261G probably damaging Het
Ccdc27 T C 4: 154,036,484 E285G unknown Het
Cct3 T A 3: 88,313,557 D298E probably damaging Het
Cd59b T A 2: 104,080,986 probably benign Het
Cdh2 T C 18: 16,629,576 N437S probably benign Het
Celsr3 T A 9: 108,842,633 I2470N probably damaging Het
Cfap100 G A 6: 90,415,906 probably benign Het
Cfap45 A T 1: 172,532,189 R98S possibly damaging Het
Cfap54 T A 10: 92,870,669 H2757L unknown Het
Chd1 C A 17: 15,725,431 N72K probably benign Het
Cntn4 A T 6: 106,667,540 probably benign Het
Cstf2t A T 19: 31,084,626 M521L probably benign Het
Daam2 A T 17: 49,498,883 probably benign Het
Ddias A T 7: 92,859,337 W457R probably benign Het
Ddr2 C T 1: 169,994,629 V417I probably benign Het
Dhx57 T C 17: 80,270,371 T570A probably damaging Het
Dmp1 A G 5: 104,207,630 E32G possibly damaging Het
Dtymk C T 1: 93,801,788 V14M possibly damaging Het
Dync2li1 G A 17: 84,649,271 M286I probably benign Het
Eea1 G A 10: 96,021,667 D664N possibly damaging Het
Esp6 G T 17: 40,565,396 V112L probably benign Het
Fam83h G T 15: 76,006,169 Q127K probably damaging Het
Gabbr2 G A 4: 46,677,474 T802I probably benign Het
Gart C A 16: 91,623,403 D851Y possibly damaging Het
Gemin6 T A 17: 80,228,095 H161Q probably damaging Het
Gm10912 T C 2: 104,066,530 S5P probably benign Het
Gm4907 A T X: 23,907,051 I264F probably benign Het
Gm5941 G A X: 92,490,211 A62T possibly damaging Het
Gng2 G T 14: 19,891,295 D26E probably benign Het
Gpr33 A G 12: 52,023,635 V207A probably benign Het
Gstm3 T A 3: 107,966,270 probably benign Het
Havcr1 T C 11: 46,752,432 C60R probably damaging Het
Hspg2 T C 4: 137,541,440 S2157P probably benign Het
Ift140 A G 17: 25,090,933 T1105A probably benign Het
Igsf8 C A 1: 172,316,259 A56D possibly damaging Het
Kat6a G T 8: 22,862,214 A5S probably damaging Het
Kctd16 A G 18: 40,530,775 E319G probably damaging Het
Kmo T C 1: 175,647,140 V157A possibly damaging Het
Lrp5 T A 19: 3,605,308 I1071F probably damaging Het
Lrrc17 A G 5: 21,561,278 T253A probably benign Het
Mast2 T A 4: 116,311,767 H769L probably damaging Het
Mast4 T C 13: 102,853,900 K50E probably damaging Het
Mbd5 A G 2: 49,256,689 T304A possibly damaging Het
Mbp T C 18: 82,572,870 S73P probably damaging Het
Mc5r T A 18: 68,339,092 V174E probably damaging Het
Med13 T A 11: 86,307,038 T736S probably benign Het
Med13l T C 5: 118,671,002 probably benign Het
Mlh3 C G 12: 85,235,714 A1382P possibly damaging Het
Mpdz T C 4: 81,359,991 probably benign Het
Muc5ac A G 7: 141,796,265 T582A possibly damaging Het
Mum1l1 T A X: 139,235,695 D327E probably damaging Het
Nalcn A G 14: 123,464,740 F453S probably damaging Het
Nrap T A 19: 56,345,474 M902L probably damaging Het
Nup85 C T 11: 115,568,370 R100* probably null Het
Nxf1 T G 19: 8,764,591 N296K probably damaging Het
Ogg1 A G 6: 113,328,420 T65A probably damaging Het
Ogt A G X: 101,644,199 probably benign Het
Olfr1258 A G 2: 89,930,201 T131A probably benign Het
Olfr1298 C T 2: 111,645,791 V69I probably benign Het
Olfr504 T A 7: 108,565,276 N173I probably benign Het
Olfr558 T A 7: 102,709,995 H245Q probably damaging Het
Ovol2 T C 2: 144,331,790 D24G probably damaging Het
Pabpc1 A G 15: 36,599,054 probably benign Het
Pak6 T C 2: 118,693,687 L441P probably damaging Het
Pappa T A 4: 65,189,315 C654* probably null Het
Paqr6 T A 3: 88,365,991 S97T probably damaging Het
Parp14 T C 16: 35,858,518 N360S probably benign Het
Pclo G T 5: 14,677,859 G2244* probably null Het
Pdzrn3 A T 6: 101,155,942 probably null Het
Pes1 T C 11: 3,975,557 M220T probably damaging Het
Phip A T 9: 82,876,221 V1473E probably benign Het
Pkd2l2 T A 18: 34,430,268 probably null Het
Plch1 T C 3: 63,753,256 D302G probably damaging Het
Plekhh2 A G 17: 84,618,031 T1419A probably benign Het
Ppara A T 15: 85,798,171 E356V probably damaging Het
Ppp1r37 G A 7: 19,532,177 P555S probably benign Het
Ppp6r1 T C 7: 4,639,710 E545G possibly damaging Het
Proser3 G A 7: 30,540,699 H327Y probably damaging Het
Prss43 T A 9: 110,829,508 I292N probably damaging Het
Pygl G C 12: 70,206,404 N271K probably damaging Het
Rassf7 T A 7: 141,216,990 probably benign Het
Rfx2 T C 17: 56,803,722 Y88C probably damaging Het
Rpl6 T C 5: 121,208,478 V214A probably benign Het
Rspo1 T A 4: 124,991,432 probably null Het
Sav1 A C 12: 69,966,205 L366V probably benign Het
Sema3b T G 9: 107,604,156 T52P possibly damaging Het
Senp6 A G 9: 80,116,559 D40G probably damaging Het
Sh3pxd2a A G 19: 47,268,207 S719P probably damaging Het
Slc34a3 G T 2: 25,231,233 D307E probably benign Het
Slc35b3 T C 13: 38,937,275 I330V probably benign Het
Slc4a10 G A 2: 62,243,398 C268Y probably benign Het
Slco6d1 A G 1: 98,421,399 E65G probably benign Het
Slit2 A G 5: 48,245,573 probably benign Het
Smcr8 T C 11: 60,778,115 Y30H probably damaging Het
Snap47 A G 11: 59,438,500 probably benign Het
Snrnp25 G A 11: 32,206,960 V15I probably damaging Het
Spns2 T C 11: 72,454,397 Y449C probably damaging Het
Stab2 T A 10: 86,924,450 probably benign Het
Strip1 C A 3: 107,614,613 D750Y probably damaging Het
Taf1c A T 8: 119,599,983 I438N probably damaging Het
Tbc1d2 T A 4: 46,609,003 K745* probably null Het
Tctn1 T C 5: 122,264,144 T76A probably damaging Het
Tfpi T C 2: 84,443,320 probably benign Het
Timm44 A T 8: 4,266,592 H317Q probably benign Het
Tnfaip1 A T 11: 78,530,014 probably benign Het
Tnpo3 A T 6: 29,554,993 probably benign Het
Top3b T C 16: 16,879,437 probably benign Het
Trak1 T A 9: 121,453,285 M410K possibly damaging Het
Trpm3 C A 19: 22,978,654 P1160Q probably damaging Het
Tyk2 T A 9: 21,111,137 T799S possibly damaging Het
Ubfd1 G A 7: 122,067,491 probably benign Het
Unc13a G A 8: 71,642,173 R1272* probably null Het
Unc45b T A 11: 82,940,205 L797Q possibly damaging Het
Urb2 C T 8: 124,030,970 Q1139* probably null Het
Vmn2r66 A T 7: 85,007,862 S112T probably benign Het
Vmn2r71 A T 7: 85,623,634 D552V probably benign Het
Vmn2r76 A G 7: 86,228,696 Y498H probably benign Het
Vmn2r84 A C 10: 130,391,115 W285G probably damaging Het
Vps72 G T 3: 95,122,583 L304F probably damaging Het
Wiz A T 17: 32,356,441 I907N probably damaging Het
Yaf2 T C 15: 93,285,536 K131R probably damaging Het
Zfp141 A T 7: 42,476,056 Y331N possibly damaging Het
Zfp324 G T 7: 12,971,024 C380F probably damaging Het
Zfp521 T C 18: 13,845,062 T765A probably benign Het
Zfp616 A T 11: 74,085,674 H923L probably damaging Het
Zfpm1 C T 8: 122,335,846 T548M probably damaging Het
Zp2 A T 7: 120,143,576 probably benign Het
Other mutations in Shank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Shank1 APN 7 44354238 missense possibly damaging 0.89
IGL01293:Shank1 APN 7 44354236 missense possibly damaging 0.59
IGL01319:Shank1 APN 7 44353123 missense possibly damaging 0.93
IGL01347:Shank1 APN 7 44342120 missense unknown
IGL01621:Shank1 APN 7 44342465 missense unknown
IGL01621:Shank1 APN 7 44351599 missense unknown
IGL01964:Shank1 APN 7 44325678 missense unknown
IGL02309:Shank1 APN 7 44312842 missense unknown
IGL02325:Shank1 APN 7 44327080 nonsense probably null
IGL02387:Shank1 APN 7 44356937 missense possibly damaging 0.77
IGL02958:Shank1 APN 7 44354473 missense possibly damaging 0.59
R0098:Shank1 UTSW 7 44313285 missense unknown
R0098:Shank1 UTSW 7 44313285 missense unknown
R0197:Shank1 UTSW 7 44352294 missense unknown
R0326:Shank1 UTSW 7 44319170 missense unknown
R0365:Shank1 UTSW 7 44353977 missense possibly damaging 0.89
R1033:Shank1 UTSW 7 44356796 missense possibly damaging 0.77
R1390:Shank1 UTSW 7 44357038 missense probably damaging 1.00
R1453:Shank1 UTSW 7 44316075 missense unknown
R1594:Shank1 UTSW 7 44327223 nonsense probably null
R1713:Shank1 UTSW 7 44319737 missense unknown
R1783:Shank1 UTSW 7 44352737 missense possibly damaging 0.70
R1869:Shank1 UTSW 7 44342115 nonsense probably null
R1870:Shank1 UTSW 7 44342115 nonsense probably null
R1959:Shank1 UTSW 7 44325377 missense unknown
R1962:Shank1 UTSW 7 44344323 critical splice donor site probably null
R2406:Shank1 UTSW 7 44356952 missense possibly damaging 0.94
R2509:Shank1 UTSW 7 44351724 missense unknown
R2509:Shank1 UTSW 7 44352123 missense unknown
R3877:Shank1 UTSW 7 44344992 missense unknown
R4041:Shank1 UTSW 7 44342162 missense unknown
R4249:Shank1 UTSW 7 44319736 missense unknown
R4303:Shank1 UTSW 7 44342474 missense unknown
R4431:Shank1 UTSW 7 44319652 nonsense probably null
R4525:Shank1 UTSW 7 44354590 missense possibly damaging 0.77
R4527:Shank1 UTSW 7 44354590 missense possibly damaging 0.77
R4642:Shank1 UTSW 7 44313141 missense unknown
R4722:Shank1 UTSW 7 44313214 nonsense probably null
R4805:Shank1 UTSW 7 44343711 missense unknown
R4874:Shank1 UTSW 7 44316073 missense unknown
R4904:Shank1 UTSW 7 44334040 intron probably benign
R4939:Shank1 UTSW 7 44326162 missense unknown
R5394:Shank1 UTSW 7 44352651 missense possibly damaging 0.85
R5410:Shank1 UTSW 7 44351822 missense unknown
R5556:Shank1 UTSW 7 44344315 intron probably benign
R5620:Shank1 UTSW 7 44312736 missense unknown
R5656:Shank1 UTSW 7 44352886 missense probably benign 0.33
R5688:Shank1 UTSW 7 44354487 missense possibly damaging 0.77
R5740:Shank1 UTSW 7 44353740 missense possibly damaging 0.89
R5801:Shank1 UTSW 7 44356816 missense possibly damaging 0.77
R6179:Shank1 UTSW 7 44357206 missense possibly damaging 0.58
R6186:Shank1 UTSW 7 44352566 missense probably benign 0.18
R6245:Shank1 UTSW 7 44352253 missense unknown
R6500:Shank1 UTSW 7 44327221 missense unknown
R6602:Shank1 UTSW 7 44352336 missense probably benign 0.03
R6655:Shank1 UTSW 7 44327220 missense unknown
R6709:Shank1 UTSW 7 44354176 missense probably benign 0.43
R6734:Shank1 UTSW 7 44353686 missense probably benign 0.01
R6881:Shank1 UTSW 7 44351793 missense unknown
R6902:Shank1 UTSW 7 44356815 missense probably benign 0.39
R6975:Shank1 UTSW 7 44313106 splice site probably null
R6985:Shank1 UTSW 7 44344913 missense unknown
R7072:Shank1 UTSW 7 44344946 missense unknown
R7116:Shank1 UTSW 7 44327161 missense unknown
R7117:Shank1 UTSW 7 44327161 missense unknown
R7199:Shank1 UTSW 7 44353140 missense possibly damaging 0.86
R7249:Shank1 UTSW 7 44327161 missense unknown
R7252:Shank1 UTSW 7 44327161 missense unknown
X0019:Shank1 UTSW 7 44356928 missense probably damaging 1.00
X0065:Shank1 UTSW 7 44351929 missense unknown
Z1088:Shank1 UTSW 7 44352166 missense unknown
Predicted Primers PCR Primer
(F):5'- GGGCCGAGAGAAGAGCCTATATCAC -3'
(R):5'- CCACTAGGGCTGCTCCAAACTG -3'

Sequencing Primer
(F):5'- ccaccaccacccacctc -3'
(R):5'- CTAGTGAAATCCAGGGTGGC -3'
Posted On2013-11-07