Incidental Mutation 'R0883:Unc13a'
ID80833
Institutional Source Beutler Lab
Gene Symbol Unc13a
Ensembl Gene ENSMUSG00000034799
Gene Nameunc-13 homolog A (C. elegans)
Synonyms2410078G03Rik, Munc13-1
MMRRC Submission 039050-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0883 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location71624417-71671757 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 71642173 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 1272 (R1272*)
Ref Sequence ENSEMBL: ENSMUSP00000135189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030170] [ENSMUST00000177517]
Predicted Effect probably null
Transcript: ENSMUST00000030170
AA Change: R1272*
SMART Domains Protein: ENSMUSP00000030170
Gene: ENSMUSG00000034799
AA Change: R1272*

DomainStartEndE-ValueType
C2 3 94 5.23e-10 SMART
low complexity region 187 202 N/A INTRINSIC
low complexity region 264 277 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
coiled coil region 321 359 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 435 450 N/A INTRINSIC
PDB:2KDU|B 454 488 3e-16 PDB
C1 563 612 3.93e-18 SMART
C2 686 793 5.86e-22 SMART
DUF1041 1002 1111 1.6e-56 SMART
Pfam:Membr_traf_MHD 1355 1520 6.3e-53 PFAM
C2 1555 1661 5.03e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000175909
Predicted Effect probably null
Transcript: ENSMUST00000176127
AA Change: R180*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177032
Predicted Effect probably null
Transcript: ENSMUST00000177517
AA Change: R1272*
SMART Domains Protein: ENSMUSP00000135189
Gene: ENSMUSG00000034799
AA Change: R1272*

DomainStartEndE-ValueType
C2 3 94 5.23e-10 SMART
low complexity region 187 202 N/A INTRINSIC
low complexity region 264 277 N/A INTRINSIC
low complexity region 299 310 N/A INTRINSIC
coiled coil region 321 359 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 435 450 N/A INTRINSIC
PDB:2KDU|B 454 488 3e-16 PDB
C1 563 612 3.93e-18 SMART
C2 686 793 5.86e-22 SMART
DUF1041 1002 1111 1.6e-56 SMART
Pfam:Membr_traf_MHD 1355 1520 6.7e-53 PFAM
C2 1574 1680 5.03e-12 SMART
Meta Mutation Damage Score 0.67 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 98% (148/151)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the UNC13 family. UNC13 proteins bind to phorbol esters and diacylglycerol and play important roles in neurotransmitter release at synapses. Single nucleotide polymorphisms in this gene may be associated with sporadic amyotrophic lateral sclerosis. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutant mice do not feed and die within hours of birth and synaptic vesicle maturation is impaired. Mice homozygous for a knock-in allele exhibit slower rate of synaptic vesicle replenishment, aberrant short-term depression and reduced recoveryfrom synaptic depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 150 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,871 L1607P probably damaging Het
1700016H13Rik T C 5: 103,648,821 *118W probably null Het
1700061G19Rik A T 17: 56,883,835 N468Y probably benign Het
4930595M18Rik G T X: 81,420,931 T390N possibly damaging Het
Abca13 C T 11: 9,291,238 Q1034* probably null Het
Adgra3 T C 5: 49,960,723 H1161R probably damaging Het
AF529169 T C 9: 89,602,417 H309R probably benign Het
Aff1 T C 5: 103,826,138 probably benign Het
Agap2 A G 10: 127,091,702 T1131A possibly damaging Het
Ankrd12 A G 17: 65,985,132 V1102A probably benign Het
Ankrd54 A T 15: 79,062,731 C23S probably damaging Het
Anxa10 C T 8: 62,077,967 V70I probably benign Het
Asap3 T C 4: 136,234,325 probably benign Het
Asb13 T C 13: 3,645,052 probably null Het
Atp6v1a A T 16: 44,101,692 probably benign Het
Atp8b1 T G 18: 64,564,541 I411L probably benign Het
Baiap3 T A 17: 25,249,101 N313I probably damaging Het
Bok T C 1: 93,686,487 I14T probably benign Het
Bri3bp T A 5: 125,441,744 probably null Het
C2cd2l A G 9: 44,316,202 L186P probably damaging Het
Cadm2 A T 16: 66,882,814 C44S probably damaging Het
Capn11 T C 17: 45,638,881 probably benign Het
Carm1 T A 9: 21,569,591 probably benign Het
Ccdc189 T C 7: 127,584,862 E261G probably damaging Het
Ccdc27 T C 4: 154,036,484 E285G unknown Het
Cct3 T A 3: 88,313,557 D298E probably damaging Het
Cd59b T A 2: 104,080,986 probably benign Het
Cdh2 T C 18: 16,629,576 N437S probably benign Het
Celsr3 T A 9: 108,842,633 I2470N probably damaging Het
Cfap100 G A 6: 90,415,906 probably benign Het
Cfap45 A T 1: 172,532,189 R98S possibly damaging Het
Cfap54 T A 10: 92,870,669 H2757L unknown Het
Chd1 C A 17: 15,725,431 N72K probably benign Het
Cntn4 A T 6: 106,667,540 probably benign Het
Cstf2t A T 19: 31,084,626 M521L probably benign Het
Daam2 A T 17: 49,498,883 probably benign Het
Ddias A T 7: 92,859,337 W457R probably benign Het
Ddr2 C T 1: 169,994,629 V417I probably benign Het
Dhx57 T C 17: 80,270,371 T570A probably damaging Het
Dmp1 A G 5: 104,207,630 E32G possibly damaging Het
Dtymk C T 1: 93,801,788 V14M possibly damaging Het
Dync2li1 G A 17: 84,649,271 M286I probably benign Het
Eea1 G A 10: 96,021,667 D664N possibly damaging Het
Esp6 G T 17: 40,565,396 V112L probably benign Het
Fam83h G T 15: 76,006,169 Q127K probably damaging Het
Gabbr2 G A 4: 46,677,474 T802I probably benign Het
Gart C A 16: 91,623,403 D851Y possibly damaging Het
Gemin6 T A 17: 80,228,095 H161Q probably damaging Het
Gm10912 T C 2: 104,066,530 S5P probably benign Het
Gm4907 A T X: 23,907,051 I264F probably benign Het
Gm5941 G A X: 92,490,211 A62T possibly damaging Het
Gng2 G T 14: 19,891,295 D26E probably benign Het
Gpr33 A G 12: 52,023,635 V207A probably benign Het
Gstm3 T A 3: 107,966,270 probably benign Het
Havcr1 T C 11: 46,752,432 C60R probably damaging Het
Hspg2 T C 4: 137,541,440 S2157P probably benign Het
Ift140 A G 17: 25,090,933 T1105A probably benign Het
Igsf8 C A 1: 172,316,259 A56D possibly damaging Het
Kat6a G T 8: 22,862,214 A5S probably damaging Het
Kctd16 A G 18: 40,530,775 E319G probably damaging Het
Kmo T C 1: 175,647,140 V157A possibly damaging Het
Lrp5 T A 19: 3,605,308 I1071F probably damaging Het
Lrrc17 A G 5: 21,561,278 T253A probably benign Het
Mast2 T A 4: 116,311,767 H769L probably damaging Het
Mast4 T C 13: 102,853,900 K50E probably damaging Het
Mbd5 A G 2: 49,256,689 T304A possibly damaging Het
Mbp T C 18: 82,572,870 S73P probably damaging Het
Mc5r T A 18: 68,339,092 V174E probably damaging Het
Med13 T A 11: 86,307,038 T736S probably benign Het
Med13l T C 5: 118,671,002 probably benign Het
Mlh3 C G 12: 85,235,714 A1382P possibly damaging Het
Mpdz T C 4: 81,359,991 probably benign Het
Muc5ac A G 7: 141,796,265 T582A possibly damaging Het
Mum1l1 T A X: 139,235,695 D327E probably damaging Het
Nalcn A G 14: 123,464,740 F453S probably damaging Het
Nrap T A 19: 56,345,474 M902L probably damaging Het
Nup85 C T 11: 115,568,370 R100* probably null Het
Nxf1 T G 19: 8,764,591 N296K probably damaging Het
Ogg1 A G 6: 113,328,420 T65A probably damaging Het
Ogt A G X: 101,644,199 probably benign Het
Olfr1258 A G 2: 89,930,201 T131A probably benign Het
Olfr1298 C T 2: 111,645,791 V69I probably benign Het
Olfr504 T A 7: 108,565,276 N173I probably benign Het
Olfr558 T A 7: 102,709,995 H245Q probably damaging Het
Ovol2 T C 2: 144,331,790 D24G probably damaging Het
Pabpc1 A G 15: 36,599,054 probably benign Het
Pak6 T C 2: 118,693,687 L441P probably damaging Het
Pappa T A 4: 65,189,315 C654* probably null Het
Paqr6 T A 3: 88,365,991 S97T probably damaging Het
Parp14 T C 16: 35,858,518 N360S probably benign Het
Pclo G T 5: 14,677,859 G2244* probably null Het
Pdzrn3 A T 6: 101,155,942 probably null Het
Pes1 T C 11: 3,975,557 M220T probably damaging Het
Phip A T 9: 82,876,221 V1473E probably benign Het
Pkd2l2 T A 18: 34,430,268 probably null Het
Plch1 T C 3: 63,753,256 D302G probably damaging Het
Plekhh2 A G 17: 84,618,031 T1419A probably benign Het
Ppara A T 15: 85,798,171 E356V probably damaging Het
Ppp1r37 G A 7: 19,532,177 P555S probably benign Het
Ppp6r1 T C 7: 4,639,710 E545G possibly damaging Het
Proser3 G A 7: 30,540,699 H327Y probably damaging Het
Prss43 T A 9: 110,829,508 I292N probably damaging Het
Pygl G C 12: 70,206,404 N271K probably damaging Het
Rassf7 T A 7: 141,216,990 probably benign Het
Rfx2 T C 17: 56,803,722 Y88C probably damaging Het
Rpl6 T C 5: 121,208,478 V214A probably benign Het
Rspo1 T A 4: 124,991,432 probably null Het
Sav1 A C 12: 69,966,205 L366V probably benign Het
Sema3b T G 9: 107,604,156 T52P possibly damaging Het
Senp6 A G 9: 80,116,559 D40G probably damaging Het
Sh3pxd2a A G 19: 47,268,207 S719P probably damaging Het
Shank1 C T 7: 44,352,294 R1146W unknown Het
Slc34a3 G T 2: 25,231,233 D307E probably benign Het
Slc35b3 T C 13: 38,937,275 I330V probably benign Het
Slc4a10 G A 2: 62,243,398 C268Y probably benign Het
Slco6d1 A G 1: 98,421,399 E65G probably benign Het
Slit2 A G 5: 48,245,573 probably benign Het
Smcr8 T C 11: 60,778,115 Y30H probably damaging Het
Snap47 A G 11: 59,438,500 probably benign Het
Snrnp25 G A 11: 32,206,960 V15I probably damaging Het
Spns2 T C 11: 72,454,397 Y449C probably damaging Het
Stab2 T A 10: 86,924,450 probably benign Het
Strip1 C A 3: 107,614,613 D750Y probably damaging Het
Taf1c A T 8: 119,599,983 I438N probably damaging Het
Tbc1d2 T A 4: 46,609,003 K745* probably null Het
Tctn1 T C 5: 122,264,144 T76A probably damaging Het
Tfpi T C 2: 84,443,320 probably benign Het
Timm44 A T 8: 4,266,592 H317Q probably benign Het
Tnfaip1 A T 11: 78,530,014 probably benign Het
Tnpo3 A T 6: 29,554,993 probably benign Het
Top3b T C 16: 16,879,437 probably benign Het
Trak1 T A 9: 121,453,285 M410K possibly damaging Het
Trpm3 C A 19: 22,978,654 P1160Q probably damaging Het
Tyk2 T A 9: 21,111,137 T799S possibly damaging Het
Ubfd1 G A 7: 122,067,491 probably benign Het
Unc45b T A 11: 82,940,205 L797Q possibly damaging Het
Urb2 C T 8: 124,030,970 Q1139* probably null Het
Vmn2r66 A T 7: 85,007,862 S112T probably benign Het
Vmn2r71 A T 7: 85,623,634 D552V probably benign Het
Vmn2r76 A G 7: 86,228,696 Y498H probably benign Het
Vmn2r84 A C 10: 130,391,115 W285G probably damaging Het
Vps72 G T 3: 95,122,583 L304F probably damaging Het
Wiz A T 17: 32,356,441 I907N probably damaging Het
Yaf2 T C 15: 93,285,536 K131R probably damaging Het
Zfp141 A T 7: 42,476,056 Y331N possibly damaging Het
Zfp324 G T 7: 12,971,024 C380F probably damaging Het
Zfp521 T C 18: 13,845,062 T765A probably benign Het
Zfp616 A T 11: 74,085,674 H923L probably damaging Het
Zfpm1 C T 8: 122,335,846 T548M probably damaging Het
Zp2 A T 7: 120,143,576 probably benign Het
Other mutations in Unc13a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Unc13a APN 8 71643147 missense probably null 0.70
IGL01023:Unc13a APN 8 71661825 missense probably benign 0.02
IGL01456:Unc13a APN 8 71644567 missense probably damaging 1.00
IGL01820:Unc13a APN 8 71654947 missense probably damaging 0.99
IGL01909:Unc13a APN 8 71639210 splice site probably benign
IGL01925:Unc13a APN 8 71634543 missense possibly damaging 0.95
IGL02407:Unc13a APN 8 71648942 missense probably damaging 0.99
IGL02622:Unc13a APN 8 71652514 splice site probably null
IGL02634:Unc13a APN 8 71655701 missense probably benign 0.03
IGL02724:Unc13a APN 8 71656305 splice site probably benign
IGL02892:Unc13a APN 8 71649910 missense probably damaging 1.00
IGL02948:Unc13a APN 8 71650549 missense possibly damaging 0.63
IGL03081:Unc13a APN 8 71649549 missense probably damaging 0.98
IGL03372:Unc13a APN 8 71655709 missense probably damaging 1.00
curvy UTSW 8 71630504 splice site probably null
greed UTSW 8 71654845 missense probably damaging 1.00
largesse UTSW 8 71634658 missense probably damaging 1.00
serpiginous UTSW 8 71664245 missense probably damaging 1.00
PIT4469001:Unc13a UTSW 8 71658314 nonsense probably null
R0067:Unc13a UTSW 8 71634658 missense probably damaging 1.00
R0067:Unc13a UTSW 8 71634658 missense probably damaging 1.00
R0389:Unc13a UTSW 8 71658032 missense probably benign 0.01
R0457:Unc13a UTSW 8 71658001 critical splice donor site probably null
R0478:Unc13a UTSW 8 71651148 missense possibly damaging 0.92
R0483:Unc13a UTSW 8 71644913 missense probably damaging 0.96
R0609:Unc13a UTSW 8 71658467 missense probably damaging 0.96
R0611:Unc13a UTSW 8 71649865 missense probably damaging 1.00
R0730:Unc13a UTSW 8 71656285 missense possibly damaging 0.68
R1162:Unc13a UTSW 8 71647917 missense probably benign 0.31
R1185:Unc13a UTSW 8 71661833 missense probably benign 0.13
R1185:Unc13a UTSW 8 71661833 missense probably benign 0.13
R1185:Unc13a UTSW 8 71661833 missense probably benign 0.13
R1196:Unc13a UTSW 8 71654986 missense probably damaging 1.00
R1400:Unc13a UTSW 8 71651221 missense probably damaging 1.00
R1446:Unc13a UTSW 8 71648981 missense possibly damaging 0.91
R1507:Unc13a UTSW 8 71658266 missense probably benign
R1636:Unc13a UTSW 8 71653390 missense probably damaging 1.00
R1858:Unc13a UTSW 8 71652399 missense probably damaging 1.00
R2025:Unc13a UTSW 8 71639768 missense possibly damaging 0.92
R2107:Unc13a UTSW 8 71656251 splice site probably null
R2286:Unc13a UTSW 8 71630559 missense probably damaging 1.00
R2334:Unc13a UTSW 8 71634558 missense probably damaging 1.00
R2924:Unc13a UTSW 8 71644952 missense possibly damaging 0.88
R3177:Unc13a UTSW 8 71629695 missense probably benign 0.01
R3277:Unc13a UTSW 8 71629695 missense probably benign 0.01
R4175:Unc13a UTSW 8 71667724 intron probably benign
R4279:Unc13a UTSW 8 71666667 missense probably damaging 0.98
R4629:Unc13a UTSW 8 71653453 missense possibly damaging 0.65
R4803:Unc13a UTSW 8 71662850 splice site probably null
R4877:Unc13a UTSW 8 71658616 missense possibly damaging 0.85
R4927:Unc13a UTSW 8 71654845 missense probably damaging 1.00
R4930:Unc13a UTSW 8 71630504 splice site probably null
R4994:Unc13a UTSW 8 71643172 missense probably benign 0.28
R5011:Unc13a UTSW 8 71641477 nonsense probably null
R5252:Unc13a UTSW 8 71652564 missense probably damaging 1.00
R5356:Unc13a UTSW 8 71662514 missense probably benign 0.02
R5458:Unc13a UTSW 8 71664245 missense probably damaging 1.00
R5514:Unc13a UTSW 8 71643151 missense probably damaging 1.00
R5784:Unc13a UTSW 8 71655666 missense possibly damaging 0.61
R5853:Unc13a UTSW 8 71655129 splice site probably null
R6183:Unc13a UTSW 8 71644666 missense probably damaging 1.00
R6277:Unc13a UTSW 8 71666639 critical splice donor site probably null
R6374:Unc13a UTSW 8 71641453 missense possibly damaging 0.70
R6392:Unc13a UTSW 8 71637809 missense possibly damaging 0.83
R6515:Unc13a UTSW 8 71647940 missense probably benign 0.44
R6576:Unc13a UTSW 8 71653478 missense probably benign 0.00
R6943:Unc13a UTSW 8 71652377 missense probably damaging 1.00
R7045:Unc13a UTSW 8 71658763 missense possibly damaging 0.95
R7062:Unc13a UTSW 8 71663237 missense probably benign 0.00
R7146:Unc13a UTSW 8 71630553 missense probably damaging 1.00
R7260:Unc13a UTSW 8 71660585 missense possibly damaging 0.71
Z1088:Unc13a UTSW 8 71654803 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TATCCTGGAGATGCCACTCACCTG -3'
(R):5'- GCCTGTGTGACTGAGACTGTGAATC -3'

Sequencing Primer
(F):5'- CCAGGACATTGTTGAGTTTCAC -3'
(R):5'- GAGAGATATTGCTACAGACCTGCTC -3'
Posted On2013-11-07