Incidental Mutation 'R0931:Wdr7'
ID80927
Institutional Source Beutler Lab
Gene Symbol Wdr7
Ensembl Gene ENSMUSG00000040560
Gene NameWD repeat domain 7
SynonymsTGF-beta resistance associated gene, TRAG
MMRRC Submission 039075-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R0931 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location63708695-63989760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63865300 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1106 (V1106A)
Ref Sequence ENSEMBL: ENSMUSP00000072509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072726]
Predicted Effect probably benign
Transcript: ENSMUST00000072726
AA Change: V1106A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000072509
Gene: ENSMUSG00000040560
AA Change: V1106A

DomainStartEndE-ValueType
WD40 5 47 1.2e-2 SMART
WD40 53 95 3.71e-1 SMART
Blast:WD40 145 190 1e-18 BLAST
WD40 208 242 1.77e2 SMART
WD40 453 498 3.81e-5 SMART
WD40 501 546 4.26e1 SMART
WD40 549 588 1.63e-4 SMART
low complexity region 760 777 N/A INTRINSIC
low complexity region 915 927 N/A INTRINSIC
low complexity region 956 970 N/A INTRINSIC
low complexity region 1020 1040 N/A INTRINSIC
low complexity region 1181 1192 N/A INTRINSIC
Blast:WD40 1341 1380 5e-20 BLAST
WD40 1382 1422 2.73e-6 SMART
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) that may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. The encoded protein forms the beta subunit of rabconnectin-3 and binds directly with Rab3A GDP/GTP exchange protein and indirectly with Rab3A GDP/GTP activating protein; these proteins are regulators of Rab3 small G protein family members involved in control of the calcium-dependant exocytosis of neurotransmitters. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl1 G A 4: 86,249,847 A476T probably benign Het
Aknad1 T C 3: 108,752,023 S118P probably damaging Het
Arhgap20 A G 9: 51,816,741 T85A probably benign Het
Astn2 A G 4: 65,648,293 L824P probably damaging Het
Ccr1 C A 9: 123,963,790 K234N probably damaging Het
Cfap46 T C 7: 139,655,841 R203G probably damaging Het
Col8a1 A G 16: 57,628,568 I193T unknown Het
Cpa2 T C 6: 30,552,071 probably benign Het
Crabp1 T C 9: 54,768,433 L100P possibly damaging Het
Cspp1 A T 1: 10,104,286 R655W probably damaging Het
Ddx1 A T 12: 13,237,817 probably benign Het
Dnah7b T G 1: 46,099,612 probably benign Het
Dzip3 A G 16: 48,951,558 S583P probably damaging Het
Exosc1 A G 19: 41,933,237 probably benign Het
Fam160a1 A G 3: 85,673,243 S552P probably benign Het
Gas7 A T 11: 67,652,925 probably benign Het
Gm996 T C 2: 25,578,489 E470G possibly damaging Het
Gss A T 2: 155,567,689 probably benign Het
Hdhd3 G A 4: 62,499,520 R140* probably null Het
Irx2 T A 13: 72,631,556 S320T possibly damaging Het
Kcnf1 T C 12: 17,175,141 S360G possibly damaging Het
Klk1b4 T C 7: 44,211,056 L166P probably damaging Het
Klri1 A T 6: 129,697,418 probably benign Het
Mettl27 T C 5: 134,934,431 probably benign Het
Myrfl T A 10: 116,839,449 H193L probably benign Het
Nbas C T 12: 13,331,114 probably benign Het
Olfr455 C A 6: 42,538,086 R312L probably benign Het
Olfr691 A T 7: 105,337,529 Y62* probably null Het
Papolg A G 11: 23,882,257 I177T probably damaging Het
Pdcd1 A G 1: 94,039,513 V220A probably benign Het
Psmc1 T C 12: 100,119,082 L234P probably damaging Het
Rasa2 A T 9: 96,552,404 M610K possibly damaging Het
Ryr3 A G 2: 112,653,702 F3930S probably damaging Het
Sacs G A 14: 61,203,495 V997I probably benign Het
Setdb2 A G 14: 59,423,496 probably benign Het
Ssu2 C A 6: 112,384,398 L32F probably damaging Het
Taar1 A T 10: 23,921,283 N293I probably damaging Het
Ttn A G 2: 76,781,502 probably benign Het
Vmn2r49 T C 7: 9,986,398 M389V possibly damaging Het
Zfp324 A G 7: 12,966,258 I15V probably benign Het
Other mutations in Wdr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Wdr7 APN 18 63720775 missense possibly damaging 0.83
IGL00708:Wdr7 APN 18 63778033 missense probably benign 0.42
IGL00813:Wdr7 APN 18 63735604 missense possibly damaging 0.84
IGL00840:Wdr7 APN 18 63927327 missense possibly damaging 0.80
IGL00904:Wdr7 APN 18 63796231 missense probably benign 0.43
IGL00930:Wdr7 APN 18 63740244 nonsense probably null
IGL01481:Wdr7 APN 18 63739179 missense probably damaging 1.00
IGL02121:Wdr7 APN 18 63777545 nonsense probably null
IGL02346:Wdr7 APN 18 63865336 missense probably benign 0.09
IGL02454:Wdr7 APN 18 63796228 missense probably benign 0.20
IGL02538:Wdr7 APN 18 63796235 missense probably benign 0.01
IGL02870:Wdr7 APN 18 63791843 missense probably benign
IGL03054:Wdr7 APN 18 63825121 splice site probably benign
IGL03189:Wdr7 APN 18 63760601 missense probably benign 0.17
R0014:Wdr7 UTSW 18 63904101 missense probably benign 0.03
R0022:Wdr7 UTSW 18 63777634 missense probably damaging 1.00
R0233:Wdr7 UTSW 18 63904101 missense probably benign 0.03
R0432:Wdr7 UTSW 18 63796249 missense probably damaging 0.96
R0496:Wdr7 UTSW 18 63791843 missense probably benign
R0633:Wdr7 UTSW 18 63865300 missense probably benign 0.00
R1585:Wdr7 UTSW 18 63924918 missense probably benign 0.03
R1651:Wdr7 UTSW 18 63720776 nonsense probably null
R1804:Wdr7 UTSW 18 63865440 missense probably damaging 1.00
R1874:Wdr7 UTSW 18 63728504 missense probably benign 0.02
R1985:Wdr7 UTSW 18 63760583 frame shift probably null
R2106:Wdr7 UTSW 18 63778038 missense probably damaging 1.00
R2206:Wdr7 UTSW 18 63777607 missense possibly damaging 0.95
R2207:Wdr7 UTSW 18 63777607 missense possibly damaging 0.95
R2245:Wdr7 UTSW 18 63924909 missense possibly damaging 0.60
R2407:Wdr7 UTSW 18 63760723 missense probably benign
R3804:Wdr7 UTSW 18 63720836 missense probably benign
R3880:Wdr7 UTSW 18 63724155 missense possibly damaging 0.92
R4410:Wdr7 UTSW 18 63778249 missense probably damaging 1.00
R4441:Wdr7 UTSW 18 63755210 missense probably damaging 1.00
R4485:Wdr7 UTSW 18 63777550 missense possibly damaging 0.89
R4606:Wdr7 UTSW 18 63779945 nonsense probably null
R4607:Wdr7 UTSW 18 63777580 missense probably benign 0.28
R4608:Wdr7 UTSW 18 63777580 missense probably benign 0.28
R4711:Wdr7 UTSW 18 63728465 missense probably benign
R4852:Wdr7 UTSW 18 63777949 missense probably damaging 0.98
R5197:Wdr7 UTSW 18 63738866 missense probably benign 0.02
R5213:Wdr7 UTSW 18 63755126 missense probably damaging 1.00
R5280:Wdr7 UTSW 18 63987312 missense probably benign 0.35
R5378:Wdr7 UTSW 18 63825239 critical splice donor site probably null
R6076:Wdr7 UTSW 18 63739277 missense probably damaging 1.00
R6083:Wdr7 UTSW 18 63728469 missense probably damaging 1.00
R6168:Wdr7 UTSW 18 63777977 missense probably damaging 0.98
R6234:Wdr7 UTSW 18 63724132 missense probably damaging 1.00
R6295:Wdr7 UTSW 18 63755111 missense probably damaging 1.00
R6548:Wdr7 UTSW 18 63778251 missense possibly damaging 0.87
R6566:Wdr7 UTSW 18 63755055 missense possibly damaging 0.72
R6696:Wdr7 UTSW 18 63739330 missense probably benign 0.07
R6937:Wdr7 UTSW 18 63791867 missense probably benign
R6962:Wdr7 UTSW 18 63865288 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GGTGTTCCATCTGTGTGAATCAGTGAC -3'
(R):5'- ACCCAGAGTGGTCCTGTTTCCTAAC -3'

Sequencing Primer
(F):5'- GTGAATCAGTGACATATTCTTGTCCC -3'
(R):5'- CCATCAAGGTGATCTGAGGACTTAC -3'
Posted On2013-11-07