Incidental Mutation 'R0883:Chd1'
ID80931
Institutional Source Beutler Lab
Gene Symbol Chd1
Ensembl Gene ENSMUSG00000023852
Gene Namechromodomain helicase DNA binding protein 1
Synonyms4930525N21Rik
MMRRC Submission 039050-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0883 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location15704967-15772610 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 15725431 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 72 (N72K)
Ref Sequence ENSEMBL: ENSMUSP00000134091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024627] [ENSMUST00000173311]
Predicted Effect probably benign
Transcript: ENSMUST00000024627
AA Change: N72K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024627
Gene: ENSMUSG00000023852
AA Change: N72K

DomainStartEndE-ValueType
low complexity region 17 67 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 116 136 N/A INTRINSIC
low complexity region 151 175 N/A INTRINSIC
low complexity region 213 230 N/A INTRINSIC
CHROMO 268 355 6.43e-20 SMART
CHROMO 385 443 1.19e-14 SMART
DEXDc 475 672 3.44e-34 SMART
Blast:DEXDc 692 786 2e-54 BLAST
low complexity region 787 799 N/A INTRINSIC
HELICc 816 900 8.48e-25 SMART
Blast:DEXDc 955 1234 1e-112 BLAST
PDB:4B4C|A 1119 1320 1e-132 PDB
low complexity region 1325 1348 N/A INTRINSIC
low complexity region 1377 1388 N/A INTRINSIC
DUF4208 1396 1500 5.54e-51 SMART
low complexity region 1507 1516 N/A INTRINSIC
low complexity region 1538 1549 N/A INTRINSIC
low complexity region 1626 1650 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173159
Predicted Effect probably benign
Transcript: ENSMUST00000173311
AA Change: N72K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134091
Gene: ENSMUSG00000023852
AA Change: N72K

DomainStartEndE-ValueType
low complexity region 17 67 N/A INTRINSIC
low complexity region 105 115 N/A INTRINSIC
low complexity region 116 136 N/A INTRINSIC
low complexity region 151 175 N/A INTRINSIC
low complexity region 213 230 N/A INTRINSIC
CHROMO 268 355 6.43e-20 SMART
CHROMO 385 443 1.19e-14 SMART
DEXDc 475 672 3.44e-34 SMART
Blast:DEXDc 692 786 2e-54 BLAST
low complexity region 787 799 N/A INTRINSIC
HELICc 816 900 8.48e-25 SMART
Blast:DEXDc 955 1078 2e-38 BLAST
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.0%
  • 10x: 97.8%
  • 20x: 96.1%
Validation Efficiency 98% (148/151)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with arrest of epiblast development due to increased apoptosis and cell cycle defects, abnormal rostral-caudal axis patterning, and failure to gastrulate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 150 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik T C 3: 138,069,871 L1607P probably damaging Het
1700016H13Rik T C 5: 103,648,821 *118W probably null Het
1700061G19Rik A T 17: 56,883,835 N468Y probably benign Het
4930595M18Rik G T X: 81,420,931 T390N possibly damaging Het
Abca13 C T 11: 9,291,238 Q1034* probably null Het
Adgra3 T C 5: 49,960,723 H1161R probably damaging Het
AF529169 T C 9: 89,602,417 H309R probably benign Het
Aff1 T C 5: 103,826,138 probably benign Het
Agap2 A G 10: 127,091,702 T1131A possibly damaging Het
Ankrd12 A G 17: 65,985,132 V1102A probably benign Het
Ankrd54 A T 15: 79,062,731 C23S probably damaging Het
Anxa10 C T 8: 62,077,967 V70I probably benign Het
Asap3 T C 4: 136,234,325 probably benign Het
Asb13 T C 13: 3,645,052 probably null Het
Atp6v1a A T 16: 44,101,692 probably benign Het
Atp8b1 T G 18: 64,564,541 I411L probably benign Het
Baiap3 T A 17: 25,249,101 N313I probably damaging Het
Bok T C 1: 93,686,487 I14T probably benign Het
Bri3bp T A 5: 125,441,744 probably null Het
C2cd2l A G 9: 44,316,202 L186P probably damaging Het
Cadm2 A T 16: 66,882,814 C44S probably damaging Het
Capn11 T C 17: 45,638,881 probably benign Het
Carm1 T A 9: 21,569,591 probably benign Het
Ccdc189 T C 7: 127,584,862 E261G probably damaging Het
Ccdc27 T C 4: 154,036,484 E285G unknown Het
Cct3 T A 3: 88,313,557 D298E probably damaging Het
Cd59b T A 2: 104,080,986 probably benign Het
Cdh2 T C 18: 16,629,576 N437S probably benign Het
Celsr3 T A 9: 108,842,633 I2470N probably damaging Het
Cfap100 G A 6: 90,415,906 probably benign Het
Cfap45 A T 1: 172,532,189 R98S possibly damaging Het
Cfap54 T A 10: 92,870,669 H2757L unknown Het
Cntn4 A T 6: 106,667,540 probably benign Het
Cstf2t A T 19: 31,084,626 M521L probably benign Het
Daam2 A T 17: 49,498,883 probably benign Het
Ddias A T 7: 92,859,337 W457R probably benign Het
Ddr2 C T 1: 169,994,629 V417I probably benign Het
Dhx57 T C 17: 80,270,371 T570A probably damaging Het
Dmp1 A G 5: 104,207,630 E32G possibly damaging Het
Dtymk C T 1: 93,801,788 V14M possibly damaging Het
Dync2li1 G A 17: 84,649,271 M286I probably benign Het
Eea1 G A 10: 96,021,667 D664N possibly damaging Het
Esp6 G T 17: 40,565,396 V112L probably benign Het
Fam83h G T 15: 76,006,169 Q127K probably damaging Het
Gabbr2 G A 4: 46,677,474 T802I probably benign Het
Gart C A 16: 91,623,403 D851Y possibly damaging Het
Gemin6 T A 17: 80,228,095 H161Q probably damaging Het
Gm10912 T C 2: 104,066,530 S5P probably benign Het
Gm4907 A T X: 23,907,051 I264F probably benign Het
Gm5941 G A X: 92,490,211 A62T possibly damaging Het
Gng2 G T 14: 19,891,295 D26E probably benign Het
Gpr33 A G 12: 52,023,635 V207A probably benign Het
Gstm3 T A 3: 107,966,270 probably benign Het
Havcr1 T C 11: 46,752,432 C60R probably damaging Het
Hspg2 T C 4: 137,541,440 S2157P probably benign Het
Ift140 A G 17: 25,090,933 T1105A probably benign Het
Igsf8 C A 1: 172,316,259 A56D possibly damaging Het
Kat6a G T 8: 22,862,214 A5S probably damaging Het
Kctd16 A G 18: 40,530,775 E319G probably damaging Het
Kmo T C 1: 175,647,140 V157A possibly damaging Het
Lrp5 T A 19: 3,605,308 I1071F probably damaging Het
Lrrc17 A G 5: 21,561,278 T253A probably benign Het
Mast2 T A 4: 116,311,767 H769L probably damaging Het
Mast4 T C 13: 102,853,900 K50E probably damaging Het
Mbd5 A G 2: 49,256,689 T304A possibly damaging Het
Mbp T C 18: 82,572,870 S73P probably damaging Het
Mc5r T A 18: 68,339,092 V174E probably damaging Het
Med13 T A 11: 86,307,038 T736S probably benign Het
Med13l T C 5: 118,671,002 probably benign Het
Mlh3 C G 12: 85,235,714 A1382P possibly damaging Het
Mpdz T C 4: 81,359,991 probably benign Het
Muc5ac A G 7: 141,796,265 T582A possibly damaging Het
Mum1l1 T A X: 139,235,695 D327E probably damaging Het
Nalcn A G 14: 123,464,740 F453S probably damaging Het
Nrap T A 19: 56,345,474 M902L probably damaging Het
Nup85 C T 11: 115,568,370 R100* probably null Het
Nxf1 T G 19: 8,764,591 N296K probably damaging Het
Ogg1 A G 6: 113,328,420 T65A probably damaging Het
Ogt A G X: 101,644,199 probably benign Het
Olfr1258 A G 2: 89,930,201 T131A probably benign Het
Olfr1298 C T 2: 111,645,791 V69I probably benign Het
Olfr504 T A 7: 108,565,276 N173I probably benign Het
Olfr558 T A 7: 102,709,995 H245Q probably damaging Het
Ovol2 T C 2: 144,331,790 D24G probably damaging Het
Pabpc1 A G 15: 36,599,054 probably benign Het
Pak6 T C 2: 118,693,687 L441P probably damaging Het
Pappa T A 4: 65,189,315 C654* probably null Het
Paqr6 T A 3: 88,365,991 S97T probably damaging Het
Parp14 T C 16: 35,858,518 N360S probably benign Het
Pclo G T 5: 14,677,859 G2244* probably null Het
Pdzrn3 A T 6: 101,155,942 probably null Het
Pes1 T C 11: 3,975,557 M220T probably damaging Het
Phip A T 9: 82,876,221 V1473E probably benign Het
Pkd2l2 T A 18: 34,430,268 probably null Het
Plch1 T C 3: 63,753,256 D302G probably damaging Het
Plekhh2 A G 17: 84,618,031 T1419A probably benign Het
Ppara A T 15: 85,798,171 E356V probably damaging Het
Ppp1r37 G A 7: 19,532,177 P555S probably benign Het
Ppp6r1 T C 7: 4,639,710 E545G possibly damaging Het
Proser3 G A 7: 30,540,699 H327Y probably damaging Het
Prss43 T A 9: 110,829,508 I292N probably damaging Het
Pygl G C 12: 70,206,404 N271K probably damaging Het
Rassf7 T A 7: 141,216,990 probably benign Het
Rfx2 T C 17: 56,803,722 Y88C probably damaging Het
Rpl6 T C 5: 121,208,478 V214A probably benign Het
Rspo1 T A 4: 124,991,432 probably null Het
Sav1 A C 12: 69,966,205 L366V probably benign Het
Sema3b T G 9: 107,604,156 T52P possibly damaging Het
Senp6 A G 9: 80,116,559 D40G probably damaging Het
Sh3pxd2a A G 19: 47,268,207 S719P probably damaging Het
Shank1 C T 7: 44,352,294 R1146W unknown Het
Slc34a3 G T 2: 25,231,233 D307E probably benign Het
Slc35b3 T C 13: 38,937,275 I330V probably benign Het
Slc4a10 G A 2: 62,243,398 C268Y probably benign Het
Slco6d1 A G 1: 98,421,399 E65G probably benign Het
Slit2 A G 5: 48,245,573 probably benign Het
Smcr8 T C 11: 60,778,115 Y30H probably damaging Het
Snap47 A G 11: 59,438,500 probably benign Het
Snrnp25 G A 11: 32,206,960 V15I probably damaging Het
Spns2 T C 11: 72,454,397 Y449C probably damaging Het
Stab2 T A 10: 86,924,450 probably benign Het
Strip1 C A 3: 107,614,613 D750Y probably damaging Het
Taf1c A T 8: 119,599,983 I438N probably damaging Het
Tbc1d2 T A 4: 46,609,003 K745* probably null Het
Tctn1 T C 5: 122,264,144 T76A probably damaging Het
Tfpi T C 2: 84,443,320 probably benign Het
Timm44 A T 8: 4,266,592 H317Q probably benign Het
Tnfaip1 A T 11: 78,530,014 probably benign Het
Tnpo3 A T 6: 29,554,993 probably benign Het
Top3b T C 16: 16,879,437 probably benign Het
Trak1 T A 9: 121,453,285 M410K possibly damaging Het
Trpm3 C A 19: 22,978,654 P1160Q probably damaging Het
Tyk2 T A 9: 21,111,137 T799S possibly damaging Het
Ubfd1 G A 7: 122,067,491 probably benign Het
Unc13a G A 8: 71,642,173 R1272* probably null Het
Unc45b T A 11: 82,940,205 L797Q possibly damaging Het
Urb2 C T 8: 124,030,970 Q1139* probably null Het
Vmn2r66 A T 7: 85,007,862 S112T probably benign Het
Vmn2r71 A T 7: 85,623,634 D552V probably benign Het
Vmn2r76 A G 7: 86,228,696 Y498H probably benign Het
Vmn2r84 A C 10: 130,391,115 W285G probably damaging Het
Vps72 G T 3: 95,122,583 L304F probably damaging Het
Wiz A T 17: 32,356,441 I907N probably damaging Het
Yaf2 T C 15: 93,285,536 K131R probably damaging Het
Zfp141 A T 7: 42,476,056 Y331N possibly damaging Het
Zfp324 G T 7: 12,971,024 C380F probably damaging Het
Zfp521 T C 18: 13,845,062 T765A probably benign Het
Zfp616 A T 11: 74,085,674 H923L probably damaging Het
Zfpm1 C T 8: 122,335,846 T548M probably damaging Het
Zp2 A T 7: 120,143,576 probably benign Het
Other mutations in Chd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Chd1 APN 17 15732565 missense probably benign 0.37
IGL01356:Chd1 APN 17 15749865 missense probably damaging 1.00
IGL01369:Chd1 APN 17 15754997 missense probably damaging 0.97
IGL01519:Chd1 APN 17 17378569 missense probably damaging 1.00
IGL01604:Chd1 APN 17 15770097 missense possibly damaging 0.95
IGL01635:Chd1 APN 17 17378596 missense probably damaging 1.00
IGL01721:Chd1 APN 17 15770168 missense probably damaging 1.00
IGL01959:Chd1 APN 17 15742173 missense probably damaging 1.00
IGL02367:Chd1 APN 17 17390053 missense probably damaging 0.98
IGL02476:Chd1 APN 17 15734273 missense probably damaging 1.00
IGL02756:Chd1 APN 17 15730807 missense probably damaging 0.97
IGL02817:Chd1 APN 17 15749500 missense possibly damaging 0.92
IGL03084:Chd1 APN 17 15770298 missense probably benign 0.22
IGL03108:Chd1 APN 17 15725281 missense possibly damaging 0.70
holly UTSW 17 15726283 missense possibly damaging 0.72
R0053:Chd1 UTSW 17 15747189 missense probably damaging 1.00
R0053:Chd1 UTSW 17 15747189 missense probably damaging 1.00
R0128:Chd1 UTSW 17 17393567 missense probably damaging 1.00
R0197:Chd1 UTSW 17 15725431 missense probably benign
R0285:Chd1 UTSW 17 17374680 splice site probably benign
R0326:Chd1 UTSW 17 15768566 missense probably damaging 1.00
R0326:Chd1 UTSW 17 15768568 missense probably benign
R0372:Chd1 UTSW 17 17387290 missense probably benign 0.14
R0391:Chd1 UTSW 17 15749894 missense probably damaging 1.00
R0486:Chd1 UTSW 17 15734342 missense probably damaging 0.99
R0637:Chd1 UTSW 17 15742288 missense possibly damaging 0.50
R0675:Chd1 UTSW 17 15758261 unclassified probably benign
R0701:Chd1 UTSW 17 15725431 missense probably benign
R0788:Chd1 UTSW 17 15707114 missense possibly damaging 0.86
R0848:Chd1 UTSW 17 15770241 missense probably damaging 1.00
R1169:Chd1 UTSW 17 15735732 missense probably damaging 1.00
R1218:Chd1 UTSW 17 15725312 missense probably damaging 1.00
R1370:Chd1 UTSW 17 17387480 missense probably benign 0.00
R1470:Chd1 UTSW 17 15726283 missense possibly damaging 0.72
R1470:Chd1 UTSW 17 15726283 missense possibly damaging 0.72
R1478:Chd1 UTSW 17 15739507 missense probably damaging 0.99
R1752:Chd1 UTSW 17 15743232 critical splice donor site probably null
R1759:Chd1 UTSW 17 17387271 missense probably benign 0.00
R1767:Chd1 UTSW 17 15770303 missense probably damaging 1.00
R1938:Chd1 UTSW 17 15762486 missense probably benign 0.39
R2007:Chd1 UTSW 17 15731006 missense probably damaging 1.00
R2069:Chd1 UTSW 17 15742294 missense probably damaging 1.00
R3771:Chd1 UTSW 17 17374651 missense probably damaging 1.00
R3773:Chd1 UTSW 17 17374651 missense probably damaging 1.00
R3849:Chd1 UTSW 17 15731871 missense probably damaging 1.00
R4241:Chd1 UTSW 17 15770027 nonsense probably null
R4242:Chd1 UTSW 17 15770027 nonsense probably null
R4354:Chd1 UTSW 17 17390001 missense probably benign 0.23
R4468:Chd1 UTSW 17 15760395 missense probably damaging 0.99
R4469:Chd1 UTSW 17 15760395 missense probably damaging 0.99
R4731:Chd1 UTSW 17 17377817 missense probably benign 0.36
R4824:Chd1 UTSW 17 15733124 missense probably damaging 1.00
R4840:Chd1 UTSW 17 15768753 nonsense probably null
R4840:Chd1 UTSW 17 15768754 missense probably damaging 1.00
R4880:Chd1 UTSW 17 17374654 missense probably damaging 1.00
R4960:Chd1 UTSW 17 15742231 missense probably damaging 0.96
R5071:Chd1 UTSW 17 15762405 missense probably benign
R5078:Chd1 UTSW 17 15726354 missense possibly damaging 0.93
R5114:Chd1 UTSW 17 15728198 missense probably benign 0.25
R5268:Chd1 UTSW 17 15735743 missense probably damaging 1.00
R5304:Chd1 UTSW 17 15754951 missense probably benign 0.01
R5304:Chd1 UTSW 17 15770268 missense possibly damaging 0.55
R5307:Chd1 UTSW 17 15732570 missense probably damaging 1.00
R5458:Chd1 UTSW 17 15738549 missense probably damaging 1.00
R5553:Chd1 UTSW 17 17385613 missense probably benign 0.17
R5623:Chd1 UTSW 17 15754932 missense probably damaging 1.00
R6022:Chd1 UTSW 17 17377773 missense probably benign 0.39
R6137:Chd1 UTSW 17 15758688 missense probably damaging 1.00
R6257:Chd1 UTSW 17 15730203 intron probably null
R6373:Chd1 UTSW 17 15738636 missense probably damaging 1.00
R6458:Chd1 UTSW 17 15730602 missense probably benign 0.01
R6476:Chd1 UTSW 17 17380988 critical splice donor site probably null
R6508:Chd1 UTSW 17 15738633 missense probably benign 0.31
R6553:Chd1 UTSW 17 15725430 missense probably benign 0.00
R6745:Chd1 UTSW 17 17387167 missense probably benign 0.08
R7107:Chd1 UTSW 17 15761366 missense probably damaging 0.98
R7317:Chd1 UTSW 17 15742274 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TGATTGTGGGTCAGCATCAGGC -3'
(R):5'- ATCCCCTTGGGCAGATAGACAGAC -3'

Sequencing Primer
(F):5'- GCTCTGACTCAGGAAGTCAATCA -3'
(R):5'- CAACCACTTGGTGCTTGTG -3'
Posted On2013-11-07