Incidental Mutation 'R0932:Ibtk'
ID80982
Institutional Source Beutler Lab
Gene Symbol Ibtk
Ensembl Gene ENSMUSG00000035941
Gene Nameinhibitor of Bruton agammaglobulinemia tyrosine kinase
Synonyms5430411K16Rik
MMRRC Submission 039076-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0932 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location85687360-85749334 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 85735046 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 158 (G158R)
Ref Sequence ENSEMBL: ENSMUSP00000139424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039213] [ENSMUST00000187521]
Predicted Effect probably damaging
Transcript: ENSMUST00000039213
AA Change: G158R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041145
Gene: ENSMUSG00000035941
AA Change: G158R

DomainStartEndE-ValueType
ANK 51 80 2e0 SMART
ANK 85 114 2.58e-3 SMART
Pfam:RCC1 143 192 8.1e-10 PFAM
Pfam:RCC1 195 244 1.1e-14 PFAM
Pfam:RCC1 247 299 5.3e-13 PFAM
low complexity region 307 318 N/A INTRINSIC
low complexity region 543 551 N/A INTRINSIC
BTB 565 745 5.48e-13 SMART
BTB 769 872 4.09e-12 SMART
low complexity region 977 990 N/A INTRINSIC
low complexity region 1269 1281 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185353
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186447
Predicted Effect probably damaging
Transcript: ENSMUST00000187521
AA Change: G158R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139424
Gene: ENSMUSG00000035941
AA Change: G158R

DomainStartEndE-ValueType
ANK 51 80 1.3e-2 SMART
ANK 85 114 1.7e-5 SMART
Pfam:RCC1 143 192 1.9e-8 PFAM
Pfam:RCC1 195 244 1.4e-12 PFAM
Pfam:RCC1 247 299 2.7e-10 PFAM
low complexity region 307 318 N/A INTRINSIC
Meta Mutation Damage Score 0.48 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.2%
  • 20x: 97.1%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Bruton tyrosine kinase (BTK) is a protein tyrosine kinase that is expressed in B cells, macrophages, and neutrophils. The protein encoded by this gene binds to BTK and downregulates BTK's kinase activity. In addition, the encoded protein disrupts BTK-mediated calcium mobilization and negatively regulates the activation of nuclear factor-kappa-B-driven transcription. This gene has a pseudogene on chromosome 18. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit more sustained calcium fluxes in spleen cells stimulated with IgM. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438H23Rik T C 16: 91,056,107 N47S probably benign Het
AA986860 T C 1: 130,737,693 probably null Het
Akap9 T A 5: 4,046,492 C2456S possibly damaging Het
Anks3 C T 16: 4,953,827 R111H probably damaging Het
Atp1a3 A T 7: 24,987,976 probably null Het
Bahd1 T C 2: 118,915,927 L9P probably damaging Het
Capn12 T C 7: 28,887,698 V364A possibly damaging Het
Cds1 T A 5: 101,797,025 C122S probably damaging Het
Cenpc1 T C 5: 86,037,600 T351A possibly damaging Het
Cuzd1 T C 7: 131,320,194 probably benign Het
Daxx T C 17: 33,910,661 L72P probably damaging Het
Depdc1b A G 13: 108,386,835 I415V probably benign Het
Dlg2 T C 7: 92,375,637 V675A probably damaging Het
Dtx4 A G 19: 12,492,151 V204A probably benign Het
Ganc T C 2: 120,458,129 V872A probably damaging Het
Gm14403 A T 2: 177,507,017 R38W probably benign Het
Gm4553 T C 7: 142,165,686 S2G unknown Het
Gm8159 G A 14: 4,635,226 R148H possibly damaging Het
Gsdmc3 T C 15: 63,858,551 probably null Het
Irx2 T A 13: 72,631,556 S320T possibly damaging Het
Kctd7 A T 5: 130,151,669 probably null Het
Kdr T C 5: 75,968,805 T141A probably benign Het
Krt25 T A 11: 99,321,283 Q176L possibly damaging Het
Krt71 T C 15: 101,736,760 N372S probably benign Het
Mllt3 A G 4: 87,789,384 V446A probably damaging Het
Olfr1282 A T 2: 111,335,198 D293E probably benign Het
Olfr311 T C 11: 58,841,714 V200A possibly damaging Het
Olfr472 A C 7: 107,903,190 T158P possibly damaging Het
Olfr481 C T 7: 108,081,520 T242M probably damaging Het
Olfr50 T A 2: 36,793,891 Y218* probably null Het
Poldip2 T C 11: 78,512,468 S18P possibly damaging Het
Ptprd T G 4: 76,136,885 Q193P probably damaging Het
Reck C T 4: 43,922,838 T371M possibly damaging Het
Rnf144b G T 13: 47,220,525 R66L probably null Het
Rpn2 T A 2: 157,283,771 D67E possibly damaging Het
Scn11a A G 9: 119,807,810 F275S probably damaging Het
Slc12a5 G A 2: 164,996,885 probably benign Het
Snapc4 A G 2: 26,374,646 I253T probably damaging Het
Tppp2 C T 14: 51,920,424 probably benign Het
Usp9y A C Y: 1,315,930 N2068K probably benign Het
Vmn2r45 A G 7: 8,475,381 C536R probably damaging Het
Other mutations in Ibtk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00656:Ibtk APN 9 85717545 splice site probably null
IGL00852:Ibtk APN 9 85713601 missense probably benign 0.01
IGL00907:Ibtk APN 9 85690331 missense possibly damaging 0.51
IGL01101:Ibtk APN 9 85732622 splice site probably benign
IGL02125:Ibtk APN 9 85735070 missense probably damaging 1.00
IGL02214:Ibtk APN 9 85714179 splice site probably benign
IGL02223:Ibtk APN 9 85710366 splice site probably benign
IGL02638:Ibtk APN 9 85719893 missense probably damaging 1.00
IGL02741:Ibtk APN 9 85726612 missense probably damaging 1.00
IGL03299:Ibtk APN 9 85721136 missense probably benign 0.27
IGL03493:Ibtk APN 9 85718919 missense probably benign 0.44
R0026:Ibtk UTSW 9 85690303 missense probably benign
R0026:Ibtk UTSW 9 85690303 missense probably benign
R0558:Ibtk UTSW 9 85737538 missense probably damaging 0.99
R0569:Ibtk UTSW 9 85708181 splice site probably benign
R0973:Ibtk UTSW 9 85743577 missense probably damaging 1.00
R1237:Ibtk UTSW 9 85720748 missense probably benign 0.00
R1245:Ibtk UTSW 9 85720742 critical splice donor site probably null
R1462:Ibtk UTSW 9 85724145 missense probably damaging 0.99
R1462:Ibtk UTSW 9 85724145 missense probably damaging 0.99
R1921:Ibtk UTSW 9 85703082 missense probably benign
R2090:Ibtk UTSW 9 85720993 missense probably benign 0.01
R2109:Ibtk UTSW 9 85706550 missense probably benign
R2277:Ibtk UTSW 9 85703151 missense probably benign
R2437:Ibtk UTSW 9 85708125 missense probably benign 0.27
R2446:Ibtk UTSW 9 85703073 missense probably benign 0.22
R3107:Ibtk UTSW 9 85710414 missense probably damaging 1.00
R3876:Ibtk UTSW 9 85718426 missense probably benign 0.06
R4160:Ibtk UTSW 9 85703090 missense probably benign 0.01
R4273:Ibtk UTSW 9 85726731 missense probably damaging 1.00
R4321:Ibtk UTSW 9 85735072 missense possibly damaging 0.49
R4827:Ibtk UTSW 9 85728554 missense probably benign 0.04
R4947:Ibtk UTSW 9 85710412 missense probably benign 0.00
R5228:Ibtk UTSW 9 85726689 missense possibly damaging 0.58
R5268:Ibtk UTSW 9 85743690 missense probably benign 0.00
R5327:Ibtk UTSW 9 85737466 critical splice donor site probably null
R5344:Ibtk UTSW 9 85735004 missense possibly damaging 0.90
R5414:Ibtk UTSW 9 85726689 missense possibly damaging 0.58
R5502:Ibtk UTSW 9 85720863 missense probably benign 0.13
R5756:Ibtk UTSW 9 85731254 missense possibly damaging 0.51
X0021:Ibtk UTSW 9 85697174 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- AGCTCCACAGGTTACCGCTCAAAG -3'
(R):5'- TGATTGCTCACATCAGAGTCAGGC -3'

Sequencing Primer
(F):5'- TTCAGGATATCAGGACCATGC -3'
(R):5'- CACATCAGAGTCAGGCTTTAACTG -3'
Posted On2013-11-07