Incidental Mutation 'R0884:Nmt2'
ID81001
Institutional Source Beutler Lab
Gene Symbol Nmt2
Ensembl Gene ENSMUSG00000026643
Gene NameN-myristoyltransferase 2
SynonymshNMT-2, A930001K02Rik
MMRRC Submission 039051-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R0884 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location3284212-3328877 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 3314785 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 271 (R271*)
Ref Sequence ENSEMBL: ENSMUSP00000100054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081932] [ENSMUST00000091504] [ENSMUST00000102989]
Predicted Effect probably null
Transcript: ENSMUST00000081932
AA Change: R302*
SMART Domains Protein: ENSMUSP00000080600
Gene: ENSMUSG00000026643
AA Change: R302*

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 46 58 N/A INTRINSIC
Pfam:NMT 170 327 1e-78 PFAM
Pfam:NMT_C 341 528 2.9e-83 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000091504
AA Change: R258*
SMART Domains Protein: ENSMUSP00000089085
Gene: ENSMUSG00000026643
AA Change: R258*

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
Pfam:NMT 124 283 2e-84 PFAM
Pfam:NMT_C 297 484 1.4e-87 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102989
AA Change: R271*
SMART Domains Protein: ENSMUSP00000100054
Gene: ENSMUSG00000026643
AA Change: R271*

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 46 58 N/A INTRINSIC
Pfam:NMT 137 296 7.8e-85 PFAM
Pfam:NMT_C 310 497 6.4e-88 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of two N-myristoyltransferase proteins. N-terminal myristoylation is a lipid modification that is involved in regulating the function and localization of signaling proteins. The encoded protein catalyzes the addition of a myristoyl group to the N-terminal glycine residue of many signaling proteins, including the human immunodeficiency virus type 1 (HIV-1) proteins, Gag and Nef. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a conditional allele knocked out in T cells exhibit reduced T cell, double positive T cell and single positive T cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A T 14: 118,553,288 I844N possibly damaging Het
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,747,059 probably benign Het
Adam6b A T 12: 113,490,995 R477S probably damaging Het
Aqp7 T A 4: 41,034,929 T175S possibly damaging Het
Bclaf1 A T 10: 20,322,076 R22* probably null Het
Bend7 A T 2: 4,744,244 K57N probably damaging Het
Bicc1 A C 10: 70,958,847 V160G probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cep72 A G 13: 74,054,881 probably null Het
Cobl A G 11: 12,375,908 I196T possibly damaging Het
Cux1 T G 5: 136,307,835 D941A probably damaging Het
Cyp2a12 T C 7: 27,032,542 I236T probably benign Het
Depdc5 T A 5: 32,917,978 V500D possibly damaging Het
Dhx35 T C 2: 158,831,711 I354T probably damaging Het
Dnase1l2 A G 17: 24,441,880 V170A possibly damaging Het
Eif4g3 C A 4: 138,151,776 N588K possibly damaging Het
Epsti1 A T 14: 77,931,275 R117S probably damaging Het
Fam53a T C 5: 33,600,816 E321G probably benign Het
Fat4 C A 3: 38,982,858 T3553K possibly damaging Het
Fer1l4 T C 2: 156,019,313 T1978A possibly damaging Het
Gabarapl2 A T 8: 111,942,505 I32F probably damaging Het
Gje1 G T 10: 14,716,740 S99R possibly damaging Het
Gm13083 A G 4: 143,615,184 D61G probably benign Het
Gosr1 A G 11: 76,730,146 I239T probably benign Het
Gpnmb T C 6: 49,047,913 V293A possibly damaging Het
Hyi T A 4: 118,360,217 I62N probably damaging Het
Il4ra A G 7: 125,574,663 I267V probably damaging Het
Kcnd2 A T 6: 21,216,541 Q81H probably benign Het
Ksr1 A T 11: 79,021,503 H675Q possibly damaging Het
Lpcat4 A G 2: 112,242,732 N208S probably damaging Het
Muc3 T A 5: 137,142,298 T162S possibly damaging Het
Mup3 T A 4: 62,087,174 I20F possibly damaging Het
Nebl A C 2: 17,411,118 S327A probably benign Het
Nfatc4 A C 14: 55,826,644 D126A probably damaging Het
Nol7 G A 13: 43,400,615 V133I probably benign Het
Olfr376 A T 11: 73,374,889 I47F probably benign Het
Olfr610 C T 7: 103,506,862 W28* probably null Het
Pde4d A T 13: 109,950,940 I670L probably damaging Het
Phlpp1 T A 1: 106,389,665 probably null Het
Pigz A G 16: 31,941,976 probably null Het
Prrg4 A T 2: 104,839,362 Y137N probably damaging Het
Rbm28 A T 6: 29,155,154 S217T possibly damaging Het
Ryr2 T C 13: 11,554,529 D4963G probably damaging Het
Slc35b2 T A 17: 45,566,825 F293I probably damaging Het
Slc35f1 A T 10: 53,089,347 Y286F probably damaging Het
Slc6a18 G T 13: 73,667,037 A384D probably damaging Het
St5 A G 7: 109,557,345 L66P probably damaging Het
Syt9 A G 7: 107,436,561 I262V probably damaging Het
Tln2 C A 9: 67,370,733 R333L probably damaging Het
Tnrc6b ACAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAG 15: 80,902,555 probably benign Het
Ttn G A 2: 76,751,066 T14834I possibly damaging Het
Uggt1 T C 1: 36,175,078 S177G probably benign Het
Zfp454 A G 11: 50,873,937 S223P probably benign Het
Zmat4 A G 8: 24,015,127 T128A probably benign Het
Other mutations in Nmt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00783:Nmt2 APN 2 3314809 missense probably damaging 1.00
IGL00784:Nmt2 APN 2 3314809 missense probably damaging 1.00
IGL01871:Nmt2 APN 2 3312674 missense probably damaging 1.00
IGL02617:Nmt2 APN 2 3314713 missense probably benign 0.15
Faul UTSW 2 3305304 intron probably null
ANU05:Nmt2 UTSW 2 3314694 missense probably benign
R0278:Nmt2 UTSW 2 3325387 missense probably benign 0.00
R0524:Nmt2 UTSW 2 3305437 missense probably benign
R0743:Nmt2 UTSW 2 3314785 nonsense probably null
R1895:Nmt2 UTSW 2 3322635 missense probably benign 0.11
R1946:Nmt2 UTSW 2 3322635 missense probably benign 0.11
R1957:Nmt2 UTSW 2 3325382 missense possibly damaging 0.95
R2037:Nmt2 UTSW 2 3309581 missense probably damaging 1.00
R2656:Nmt2 UTSW 2 3307013 missense probably benign
R3422:Nmt2 UTSW 2 3284388 missense possibly damaging 0.82
R3835:Nmt2 UTSW 2 3314686 splice site probably benign
R3955:Nmt2 UTSW 2 3312498 missense probably benign 0.00
R4701:Nmt2 UTSW 2 3322641 missense probably benign
R5032:Nmt2 UTSW 2 3284392 missense probably benign
R6373:Nmt2 UTSW 2 3324951 missense probably benign 0.05
R6396:Nmt2 UTSW 2 3314701 missense probably benign 0.18
R6410:Nmt2 UTSW 2 3316178 missense probably damaging 1.00
R6863:Nmt2 UTSW 2 3305304 intron probably null
R6865:Nmt2 UTSW 2 3314729 missense probably damaging 1.00
R7100:Nmt2 UTSW 2 3312913 missense probably benign
R7139:Nmt2 UTSW 2 3284315 missense probably benign 0.01
X0067:Nmt2 UTSW 2 3324961 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAGCTTGCAAAGTGCCTACACAATG -3'
(R):5'- GCAAGATGGTAGTAAGCAACACCCC -3'

Sequencing Primer
(F):5'- GTGCCTACACAATGTGGTTTTTTTC -3'
(R):5'- ccccatcccaccccatc -3'
Posted On2013-11-07