Incidental Mutation 'R0884:Nol7'
ID81084
Institutional Source Beutler Lab
Gene Symbol Nol7
Ensembl Gene ENSMUSG00000063200
Gene Namenucleolar protein 7
Synonyms5730556I21Rik, 2210008F15Rik, NOP27, RARG-1
MMRRC Submission 039051-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R0884 (G1)
Quality Score210
Status Not validated
Chromosome13
Chromosomal Location43398390-43407097 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 43400615 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 133 (V133I)
Ref Sequence ENSEMBL: ENSMUSP00000152581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071926] [ENSMUST00000144326] [ENSMUST00000222499] [ENSMUST00000222651]
Predicted Effect probably benign
Transcript: ENSMUST00000071926
AA Change: V133I

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000071818
Gene: ENSMUSG00000063200
AA Change: V133I

DomainStartEndE-ValueType
low complexity region 24 32 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
low complexity region 66 85 N/A INTRINSIC
low complexity region 89 100 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
Pfam:NUC129 167 229 1.1e-34 PFAM
low complexity region 236 251 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144326
SMART Domains Protein: ENSMUSP00000130636
Gene: ENSMUSG00000038546

DomainStartEndE-ValueType
low complexity region 2 114 N/A INTRINSIC
SPRY 194 315 1.66e-43 SMART
LisH 347 379 6.82e-5 SMART
CTLH 385 442 9.78e-15 SMART
low complexity region 455 478 N/A INTRINSIC
CRA 596 698 1.6e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220997
Predicted Effect probably benign
Transcript: ENSMUST00000221092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222305
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222416
Predicted Effect probably benign
Transcript: ENSMUST00000222499
AA Change: V133I

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000222651
Predicted Effect probably benign
Transcript: ENSMUST00000222754
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223188
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the nucleolus, where it maintains nucleolar structure and cell growth rates. The encoded protein also functions as a tumor suppressor and regulator of angiogenesis. The RB tumor suppressor gene recruits transcription factors to this gene and positively regulates its expression. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 A T 14: 118,553,288 I844N possibly damaging Het
Acbd3 CGAGGAGGAGGAGGAGGA CGAGGAGGAGGAGGA 1: 180,747,059 probably benign Het
Adam6b A T 12: 113,490,995 R477S probably damaging Het
Aqp7 T A 4: 41,034,929 T175S possibly damaging Het
Bclaf1 A T 10: 20,322,076 R22* probably null Het
Bend7 A T 2: 4,744,244 K57N probably damaging Het
Bicc1 A C 10: 70,958,847 V160G probably damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Cep72 A G 13: 74,054,881 probably null Het
Cobl A G 11: 12,375,908 I196T possibly damaging Het
Cux1 T G 5: 136,307,835 D941A probably damaging Het
Cyp2a12 T C 7: 27,032,542 I236T probably benign Het
Depdc5 T A 5: 32,917,978 V500D possibly damaging Het
Dhx35 T C 2: 158,831,711 I354T probably damaging Het
Dnase1l2 A G 17: 24,441,880 V170A possibly damaging Het
Eif4g3 C A 4: 138,151,776 N588K possibly damaging Het
Epsti1 A T 14: 77,931,275 R117S probably damaging Het
Fam53a T C 5: 33,600,816 E321G probably benign Het
Fat4 C A 3: 38,982,858 T3553K possibly damaging Het
Fer1l4 T C 2: 156,019,313 T1978A possibly damaging Het
Gabarapl2 A T 8: 111,942,505 I32F probably damaging Het
Gje1 G T 10: 14,716,740 S99R possibly damaging Het
Gm13083 A G 4: 143,615,184 D61G probably benign Het
Gosr1 A G 11: 76,730,146 I239T probably benign Het
Gpnmb T C 6: 49,047,913 V293A possibly damaging Het
Hyi T A 4: 118,360,217 I62N probably damaging Het
Il4ra A G 7: 125,574,663 I267V probably damaging Het
Kcnd2 A T 6: 21,216,541 Q81H probably benign Het
Ksr1 A T 11: 79,021,503 H675Q possibly damaging Het
Lpcat4 A G 2: 112,242,732 N208S probably damaging Het
Muc3 T A 5: 137,142,298 T162S possibly damaging Het
Mup3 T A 4: 62,087,174 I20F possibly damaging Het
Nebl A C 2: 17,411,118 S327A probably benign Het
Nfatc4 A C 14: 55,826,644 D126A probably damaging Het
Nmt2 A T 2: 3,314,785 R271* probably null Het
Olfr376 A T 11: 73,374,889 I47F probably benign Het
Olfr610 C T 7: 103,506,862 W28* probably null Het
Pde4d A T 13: 109,950,940 I670L probably damaging Het
Phlpp1 T A 1: 106,389,665 probably null Het
Pigz A G 16: 31,941,976 probably null Het
Prrg4 A T 2: 104,839,362 Y137N probably damaging Het
Rbm28 A T 6: 29,155,154 S217T possibly damaging Het
Ryr2 T C 13: 11,554,529 D4963G probably damaging Het
Slc35b2 T A 17: 45,566,825 F293I probably damaging Het
Slc35f1 A T 10: 53,089,347 Y286F probably damaging Het
Slc6a18 G T 13: 73,667,037 A384D probably damaging Het
St5 A G 7: 109,557,345 L66P probably damaging Het
Syt9 A G 7: 107,436,561 I262V probably damaging Het
Tln2 C A 9: 67,370,733 R333L probably damaging Het
Tnrc6b ACAGCAGCAGCAGCAGCAGCAG ACAGCAGCAGCAGCAGCAG 15: 80,902,555 probably benign Het
Ttn G A 2: 76,751,066 T14834I possibly damaging Het
Uggt1 T C 1: 36,175,078 S177G probably benign Het
Zfp454 A G 11: 50,873,937 S223P probably benign Het
Zmat4 A G 8: 24,015,127 T128A probably benign Het
Other mutations in Nol7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01821:Nol7 APN 13 43398740 missense probably benign 0.02
IGL03011:Nol7 APN 13 43401293 unclassified probably benign
R0743:Nol7 UTSW 13 43400615 missense probably benign 0.19
R1480:Nol7 UTSW 13 43398628 missense probably damaging 0.99
R4379:Nol7 UTSW 13 43401575 missense probably damaging 1.00
R5435:Nol7 UTSW 13 43401372 missense possibly damaging 0.54
R7185:Nol7 UTSW 13 43406831 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CAATACTGTGAGACTAGCACCAGCC -3'
(R):5'- TCATTACCCGACAGACTGCACTTTC -3'

Sequencing Primer
(F):5'- GTTCTGAGGACACTCCATACTAGTC -3'
(R):5'- GAAGTTACTCACTTTGGTGACCAC -3'
Posted On2013-11-07