Incidental Mutation 'R0976:Cntnap2'
ID81159
Institutional Source Beutler Lab
Gene Symbol Cntnap2
Ensembl Gene ENSMUSG00000039419
Gene Namecontactin associated protein-like 2
Synonyms5430425M22Rik, Caspr2
MMRRC Submission 039105-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R0976 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location45059357-47304213 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 47271230 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 1190 (P1190L)
Ref Sequence ENSEMBL: ENSMUSP00000110288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060839] [ENSMUST00000114641] [ENSMUST00000199100]
Predicted Effect probably benign
Transcript: ENSMUST00000060839
SMART Domains Protein: ENSMUSP00000056299
Gene: ENSMUSG00000039419

DomainStartEndE-ValueType
low complexity region 39 49 N/A INTRINSIC
4.1m 59 77 4.21e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114641
AA Change: P1190L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: P1190L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FA58C 34 181 3.99e-22 SMART
LamG 208 345 5.5e-34 SMART
LamG 393 529 3.31e-28 SMART
EGF 557 591 5.04e-2 SMART
Blast:FBG 594 777 7e-68 BLAST
LamG 819 945 5.58e-35 SMART
EGF 966 1002 2.11e1 SMART
LamG 1048 1188 3.55e-28 SMART
low complexity region 1263 1273 N/A INTRINSIC
4.1m 1283 1301 4.21e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199100
SMART Domains Protein: ENSMUSP00000143528
Gene: ENSMUSG00000039419

DomainStartEndE-ValueType
low complexity region 39 49 N/A INTRINSIC
4.1m 59 77 4.21e-7 SMART
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.6%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
Arap2 T A 5: 62,649,884 I1147F probably damaging Het
Arl10 T C 13: 54,575,808 probably benign Het
Axin1 A G 17: 26,188,086 E551G probably damaging Het
Ccr6 T A 17: 8,256,422 L153Q probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cux1 T A 5: 136,313,290 D416V probably damaging Het
Cyp2c67 G T 19: 39,643,374 F126L probably damaging Het
Cyp3a57 A G 5: 145,390,468 I490V probably benign Het
Dsc1 T C 18: 20,095,041 probably null Het
Fam83f T A 15: 80,692,084 V312E probably damaging Het
Fsip2 A G 2: 82,998,031 D6724G possibly damaging Het
Gabrr3 G T 16: 59,461,524 C414F probably benign Het
Gm21738 T C 14: 19,415,963 K192R probably benign Het
Herc1 A T 9: 66,439,878 K2005M possibly damaging Het
Hist2h2bb T A 3: 96,270,086 V112E probably benign Het
Isyna1 C A 8: 70,596,286 N338K probably damaging Het
Kalrn T C 16: 34,385,390 D39G probably damaging Het
Mndal T A 1: 173,862,845 R306S possibly damaging Het
Nek2 A G 1: 191,827,237 R285G probably benign Het
Nrg2 A G 18: 36,021,091 I591T probably benign Het
Olfr52 A G 2: 86,181,808 L101S probably damaging Het
Pcdh10 T C 3: 45,380,801 S517P probably damaging Het
Pdcd2l G T 7: 34,196,346 D67E probably benign Het
Pex1 C A 5: 3,633,943 D1146E probably benign Het
Pid1 A T 1: 84,159,225 Y62N probably benign Het
Ppp4r1 T C 17: 65,841,018 *935R probably null Het
Stag1 T C 9: 100,776,824 F155L probably damaging Het
Stag1 G A 9: 100,930,016 probably null Het
Taok2 C T 7: 126,875,151 R302Q possibly damaging Het
Tbc1d8 A G 1: 39,406,801 V103A probably damaging Het
Terf2ip T A 8: 112,011,717 I79N probably damaging Het
Tgfb3 G A 12: 86,069,832 T144I probably damaging Het
Top1 A G 2: 160,717,423 N622S possibly damaging Het
Trappc9 T A 15: 72,999,974 Q489L probably damaging Het
Vmn2r69 T C 7: 85,406,900 T677A probably damaging Het
Wdr35 T C 12: 8,986,104 F292L probably benign Het
Other mutations in Cntnap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Cntnap2 APN 6 46015263 missense possibly damaging 0.92
IGL00657:Cntnap2 APN 6 46988787 missense probably damaging 0.98
IGL00846:Cntnap2 APN 6 47193038 missense probably benign 0.12
IGL00851:Cntnap2 APN 6 46484072 missense probably benign
IGL00857:Cntnap2 APN 6 47049424 missense probably benign 0.00
IGL01290:Cntnap2 APN 6 46015465 missense probably benign 0.06
IGL01445:Cntnap2 APN 6 47193013 missense probably benign 0.14
IGL01468:Cntnap2 APN 6 47271371 nonsense probably null
IGL01859:Cntnap2 APN 6 46988721 missense probably damaging 1.00
IGL02092:Cntnap2 APN 6 46234203 missense probably damaging 1.00
IGL02239:Cntnap2 APN 6 47021654 missense probably damaging 0.99
IGL02508:Cntnap2 APN 6 46234320 missense probably damaging 1.00
IGL02530:Cntnap2 APN 6 47021736 missense possibly damaging 0.48
IGL03013:Cntnap2 APN 6 47095549 missense possibly damaging 0.66
IGL02802:Cntnap2 UTSW 6 46170245 missense probably damaging 1.00
R0001:Cntnap2 UTSW 6 46530171 missense probably benign 0.04
R0007:Cntnap2 UTSW 6 45992073 missense possibly damaging 0.95
R0007:Cntnap2 UTSW 6 45992073 missense possibly damaging 0.95
R0043:Cntnap2 UTSW 6 46483983 missense probably benign 0.01
R0118:Cntnap2 UTSW 6 45060392 splice site probably null
R0352:Cntnap2 UTSW 6 45992084 splice site probably null
R0389:Cntnap2 UTSW 6 46009637 missense probably benign 0.06
R0482:Cntnap2 UTSW 6 45715816 missense probably benign 0.00
R0530:Cntnap2 UTSW 6 46529905 nonsense probably null
R0611:Cntnap2 UTSW 6 47095549 missense possibly damaging 0.66
R0630:Cntnap2 UTSW 6 46988760 missense probably damaging 0.99
R0636:Cntnap2 UTSW 6 47296708 splice site probably benign
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1195:Cntnap2 UTSW 6 46483968 missense probably benign
R1387:Cntnap2 UTSW 6 47107914 missense probably benign 0.19
R1524:Cntnap2 UTSW 6 46530679 missense probably damaging 1.00
R1609:Cntnap2 UTSW 6 46015330 missense probably benign 0.13
R1716:Cntnap2 UTSW 6 47107892 nonsense probably null
R1757:Cntnap2 UTSW 6 46759829 missense probably damaging 1.00
R1809:Cntnap2 UTSW 6 46988675 missense probably damaging 0.99
R1813:Cntnap2 UTSW 6 46530633 missense probably damaging 1.00
R2103:Cntnap2 UTSW 6 47298588 missense probably damaging 1.00
R2133:Cntnap2 UTSW 6 47298445 missense probably damaging 1.00
R3037:Cntnap2 UTSW 6 46015266 missense possibly damaging 0.57
R3899:Cntnap2 UTSW 6 45991903 missense probably benign 0.00
R4027:Cntnap2 UTSW 6 46856128 missense probably benign
R4030:Cntnap2 UTSW 6 46856128 missense probably benign
R4237:Cntnap2 UTSW 6 46530390 intron probably benign
R4445:Cntnap2 UTSW 6 46759851 missense probably benign 0.01
R4737:Cntnap2 UTSW 6 45060317 missense possibly damaging 0.65
R4740:Cntnap2 UTSW 6 45060317 missense possibly damaging 0.65
R4915:Cntnap2 UTSW 6 46530035 intron probably benign
R4918:Cntnap2 UTSW 6 46530035 intron probably benign
R4999:Cntnap2 UTSW 6 45920834 missense probably damaging 0.96
R5373:Cntnap2 UTSW 6 47107969 missense probably benign 0.00
R5374:Cntnap2 UTSW 6 47107969 missense probably benign 0.00
R5742:Cntnap2 UTSW 6 45920926 nonsense probably null
R5748:Cntnap2 UTSW 6 45715884 missense probably damaging 1.00
R5765:Cntnap2 UTSW 6 46529815 intron probably benign
R6118:Cntnap2 UTSW 6 47193077 missense possibly damaging 0.81
R6181:Cntnap2 UTSW 6 46759808 missense probably damaging 1.00
R6189:Cntnap2 UTSW 6 47271298 missense probably damaging 1.00
R6262:Cntnap2 UTSW 6 45060112 utr 5 prime probably null
R6385:Cntnap2 UTSW 6 46856180 missense probably benign 0.00
R6555:Cntnap2 UTSW 6 46759760 missense probably damaging 1.00
R6577:Cntnap2 UTSW 6 46170272 missense probably benign 0.25
R6610:Cntnap2 UTSW 6 46015257 missense probably benign 0.08
R6761:Cntnap2 UTSW 6 47049373 missense probably benign 0.27
X0018:Cntnap2 UTSW 6 46009518 missense possibly damaging 0.53
X0063:Cntnap2 UTSW 6 47021754 missense possibly damaging 0.92
X0066:Cntnap2 UTSW 6 46234245 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACCCTCCCATGTTCTTTAGCAAACG -3'
(R):5'- ACAGCAAGCTTCTGTAGTCAACCC -3'

Sequencing Primer
(F):5'- GGCACAGGGTAATATTTCATCTCC -3'
(R):5'- GTAGTCAACCCATTCTATAGCGGAG -3'
Posted On2013-11-07