Incidental Mutation 'R0976:Pdcd2l'
ID81161
Institutional Source Beutler Lab
Gene Symbol Pdcd2l
Ensembl Gene ENSMUSG00000002635
Gene Nameprogrammed cell death 2-like
Synonyms6030457N17Rik
MMRRC Submission 039105-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R0976 (G1)
Quality Score170
Status Not validated
Chromosome7
Chromosomal Location34184499-34196661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 34196346 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 67 (D67E)
Ref Sequence ENSEMBL: ENSMUSP00000002710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002710] [ENSMUST00000038027]
Predicted Effect probably benign
Transcript: ENSMUST00000002710
AA Change: D67E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002710
Gene: ENSMUSG00000002635
AA Change: D67E

DomainStartEndE-ValueType
Pfam:PDCD2_C 192 356 3e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038027
SMART Domains Protein: ENSMUSP00000049355
Gene: ENSMUSG00000036427

DomainStartEndE-ValueType
Pfam:PGI 54 546 1e-265 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125803
Predicted Effect unknown
Transcript: ENSMUST00000148381
AA Change: D55E
SMART Domains Protein: ENSMUSP00000115874
Gene: ENSMUSG00000002635
AA Change: D55E

DomainStartEndE-ValueType
Pfam:PDCD2_C 181 270 4.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206088
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.6%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
Arap2 T A 5: 62,649,884 I1147F probably damaging Het
Arl10 T C 13: 54,575,808 probably benign Het
Axin1 A G 17: 26,188,086 E551G probably damaging Het
Ccr6 T A 17: 8,256,422 L153Q probably damaging Het
Cntnap2 C T 6: 47,271,230 P1190L probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cux1 T A 5: 136,313,290 D416V probably damaging Het
Cyp2c67 G T 19: 39,643,374 F126L probably damaging Het
Cyp3a57 A G 5: 145,390,468 I490V probably benign Het
Dsc1 T C 18: 20,095,041 probably null Het
Fam83f T A 15: 80,692,084 V312E probably damaging Het
Fsip2 A G 2: 82,998,031 D6724G possibly damaging Het
Gabrr3 G T 16: 59,461,524 C414F probably benign Het
Gm21738 T C 14: 19,415,963 K192R probably benign Het
Herc1 A T 9: 66,439,878 K2005M possibly damaging Het
Hist2h2bb T A 3: 96,270,086 V112E probably benign Het
Isyna1 C A 8: 70,596,286 N338K probably damaging Het
Kalrn T C 16: 34,385,390 D39G probably damaging Het
Mndal T A 1: 173,862,845 R306S possibly damaging Het
Nek2 A G 1: 191,827,237 R285G probably benign Het
Nrg2 A G 18: 36,021,091 I591T probably benign Het
Olfr52 A G 2: 86,181,808 L101S probably damaging Het
Pcdh10 T C 3: 45,380,801 S517P probably damaging Het
Pex1 C A 5: 3,633,943 D1146E probably benign Het
Pid1 A T 1: 84,159,225 Y62N probably benign Het
Ppp4r1 T C 17: 65,841,018 *935R probably null Het
Stag1 T C 9: 100,776,824 F155L probably damaging Het
Stag1 G A 9: 100,930,016 probably null Het
Taok2 C T 7: 126,875,151 R302Q possibly damaging Het
Tbc1d8 A G 1: 39,406,801 V103A probably damaging Het
Terf2ip T A 8: 112,011,717 I79N probably damaging Het
Tgfb3 G A 12: 86,069,832 T144I probably damaging Het
Top1 A G 2: 160,717,423 N622S possibly damaging Het
Trappc9 T A 15: 72,999,974 Q489L probably damaging Het
Vmn2r69 T C 7: 85,406,900 T677A probably damaging Het
Wdr35 T C 12: 8,986,104 F292L probably benign Het
Other mutations in Pdcd2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Pdcd2l APN 7 34184821 splice site probably null
IGL00818:Pdcd2l APN 7 34184733 missense possibly damaging 0.88
IGL01417:Pdcd2l APN 7 34192745 missense probably damaging 1.00
R0600:Pdcd2l UTSW 7 34192807 missense possibly damaging 0.47
R1815:Pdcd2l UTSW 7 34186401 missense probably benign 0.06
R5215:Pdcd2l UTSW 7 34192889 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- TGCCAATCAGAATCGCTTTACCTGC -3'
(R):5'- TGTACTGCTGGGACTTCGAGACAC -3'

Sequencing Primer
(F):5'- TTCCAGCTTAGAGGCAAGAC -3'
(R):5'- ACCTCTAGCAAGCTGGGTG -3'
Posted On2013-11-07