Incidental Mutation 'R0976:Fam83f'
ID81193
Institutional Source Beutler Lab
Gene Symbol Fam83f
Ensembl Gene ENSMUSG00000022408
Gene Namefamily with sequence similarity 83, member F
Synonyms
MMRRC Submission 039105-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R0976 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location80671847-80700425 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80692084 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 312 (V312E)
Ref Sequence ENSEMBL: ENSMUSP00000023044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023044]
Predicted Effect probably damaging
Transcript: ENSMUST00000023044
AA Change: V312E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023044
Gene: ENSMUSG00000022408
AA Change: V312E

DomainStartEndE-ValueType
Pfam:DUF1669 15 291 1.5e-111 PFAM
Pfam:PLDc_2 148 286 6.4e-12 PFAM
low complexity region 346 360 N/A INTRINSIC
low complexity region 447 458 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230325
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230612
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.6%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik C T 1: 184,033,505 S119N probably benign Het
Arap2 T A 5: 62,649,884 I1147F probably damaging Het
Arl10 T C 13: 54,575,808 probably benign Het
Axin1 A G 17: 26,188,086 E551G probably damaging Het
Ccr6 T A 17: 8,256,422 L153Q probably damaging Het
Cntnap2 C T 6: 47,271,230 P1190L probably damaging Het
Cul7 T A 17: 46,663,190 L1467H probably damaging Het
Cux1 T A 5: 136,313,290 D416V probably damaging Het
Cyp2c67 G T 19: 39,643,374 F126L probably damaging Het
Cyp3a57 A G 5: 145,390,468 I490V probably benign Het
Dsc1 T C 18: 20,095,041 probably null Het
Fsip2 A G 2: 82,998,031 D6724G possibly damaging Het
Gabrr3 G T 16: 59,461,524 C414F probably benign Het
Gm21738 T C 14: 19,415,963 K192R probably benign Het
Herc1 A T 9: 66,439,878 K2005M possibly damaging Het
Hist2h2bb T A 3: 96,270,086 V112E probably benign Het
Isyna1 C A 8: 70,596,286 N338K probably damaging Het
Kalrn T C 16: 34,385,390 D39G probably damaging Het
Mndal T A 1: 173,862,845 R306S possibly damaging Het
Nek2 A G 1: 191,827,237 R285G probably benign Het
Nrg2 A G 18: 36,021,091 I591T probably benign Het
Olfr52 A G 2: 86,181,808 L101S probably damaging Het
Pcdh10 T C 3: 45,380,801 S517P probably damaging Het
Pdcd2l G T 7: 34,196,346 D67E probably benign Het
Pex1 C A 5: 3,633,943 D1146E probably benign Het
Pid1 A T 1: 84,159,225 Y62N probably benign Het
Ppp4r1 T C 17: 65,841,018 *935R probably null Het
Stag1 T C 9: 100,776,824 F155L probably damaging Het
Stag1 G A 9: 100,930,016 probably null Het
Taok2 C T 7: 126,875,151 R302Q possibly damaging Het
Tbc1d8 A G 1: 39,406,801 V103A probably damaging Het
Terf2ip T A 8: 112,011,717 I79N probably damaging Het
Tgfb3 G A 12: 86,069,832 T144I probably damaging Het
Top1 A G 2: 160,717,423 N622S possibly damaging Het
Trappc9 T A 15: 72,999,974 Q489L probably damaging Het
Vmn2r69 T C 7: 85,406,900 T677A probably damaging Het
Wdr35 T C 12: 8,986,104 F292L probably benign Het
Other mutations in Fam83f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02971:Fam83f APN 15 80672149 missense probably benign
R0212:Fam83f UTSW 15 80690578 missense probably benign 0.00
R0347:Fam83f UTSW 15 80672257 missense probably damaging 1.00
R1724:Fam83f UTSW 15 80692267 missense possibly damaging 0.65
R1725:Fam83f UTSW 15 80692267 missense possibly damaging 0.65
R1741:Fam83f UTSW 15 80692267 missense possibly damaging 0.65
R1796:Fam83f UTSW 15 80690082 missense possibly damaging 0.80
R1870:Fam83f UTSW 15 80689912 splice site probably benign
R1899:Fam83f UTSW 15 80692080 missense probably damaging 1.00
R2022:Fam83f UTSW 15 80692267 missense possibly damaging 0.65
R2114:Fam83f UTSW 15 80692267 missense possibly damaging 0.65
R2115:Fam83f UTSW 15 80692267 missense possibly damaging 0.65
R4090:Fam83f UTSW 15 80692192 missense possibly damaging 0.85
R4865:Fam83f UTSW 15 80692449 missense probably damaging 1.00
R4893:Fam83f UTSW 15 80691955 missense probably damaging 1.00
R5206:Fam83f UTSW 15 80692054 missense possibly damaging 0.86
R5739:Fam83f UTSW 15 80692005 missense probably damaging 1.00
R6468:Fam83f UTSW 15 80692111 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GCACCTTTCTCCAAACATCAGGCAG -3'
(R):5'- ATTCAGAAAGCTCTCCAGACGCCG -3'

Sequencing Primer
(F):5'- AACATCAGGCAGTGTGCCC -3'
(R):5'- CCGGGCAGACTCACCAC -3'
Posted On2013-11-07