Incidental Mutation 'R0962:Mfn2'
ID81245
Institutional Source Beutler Lab
Gene Symbol Mfn2
Ensembl Gene ENSMUSG00000029020
Gene Namemitofusin 2
Synonymshypertension related protein 1, D630023P19Rik, Fzo
MMRRC Submission 039091-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0962 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location147873599-147904704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 147882201 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 511 (N511S)
Ref Sequence ENSEMBL: ENSMUSP00000101341 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030884] [ENSMUST00000105714] [ENSMUST00000105715] [ENSMUST00000105716]
Predicted Effect probably benign
Transcript: ENSMUST00000030884
AA Change: N511S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030884
Gene: ENSMUSG00000029020
AA Change: N511S

DomainStartEndE-ValueType
Pfam:MMR_HSR1 98 258 3.8e-6 PFAM
Pfam:Dynamin_N 99 259 2e-24 PFAM
low complexity region 336 347 N/A INTRINSIC
coiled coil region 406 433 N/A INTRINSIC
Pfam:Fzo_mitofusin 594 754 1.6e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105714
AA Change: N511S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101339
Gene: ENSMUSG00000029020
AA Change: N511S

DomainStartEndE-ValueType
Pfam:MMR_HSR1 98 258 6.1e-7 PFAM
Pfam:Dynamin_N 99 259 3.6e-25 PFAM
low complexity region 336 347 N/A INTRINSIC
coiled coil region 406 433 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105715
AA Change: N511S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101340
Gene: ENSMUSG00000029020
AA Change: N511S

DomainStartEndE-ValueType
Pfam:MMR_HSR1 98 258 9e-7 PFAM
Pfam:Dynamin_N 99 259 5.4e-25 PFAM
low complexity region 336 347 N/A INTRINSIC
coiled coil region 406 433 N/A INTRINSIC
Pfam:Fzo_mitofusin 586 756 3.9e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105716
AA Change: N511S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101341
Gene: ENSMUSG00000029020
AA Change: N511S

DomainStartEndE-ValueType
Pfam:MMR_HSR1 98 258 9e-7 PFAM
Pfam:Dynamin_N 99 259 5.4e-25 PFAM
low complexity region 336 347 N/A INTRINSIC
coiled coil region 406 433 N/A INTRINSIC
Pfam:Fzo_mitofusin 586 756 3.9e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124646
Meta Mutation Damage Score 0.0704 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.9%
  • 20x: 96.0%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial membrane protein that participates in mitochondrial fusion and contributes to the maintenance and operation of the mitochondrial network. This protein is involved in the regulation of vascular smooth muscle cell proliferation, and it may play a role in the pathophysiology of obesity. Mutations in this gene cause Charcot-Marie-Tooth disease type 2A2, and hereditary motor and sensory neuropathy VI, which are both disorders of the peripheral nervous system. Defects in this gene have also been associated with early-onset stroke. Two transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die in mid-gestation. Structural and functional abnormalities of mitochondria are reported. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik T C 5: 98,566,561 probably benign Het
Acaca G A 11: 84,311,303 A196T probably damaging Het
Adamtsl4 T A 3: 95,684,488 R97* probably null Het
Adgrv1 T C 13: 81,405,346 I5470V probably benign Het
Afg3l2 T C 18: 67,405,427 T754A possibly damaging Het
Agfg1 T C 1: 82,886,396 F395S probably damaging Het
Ahnak A G 19: 9,012,848 probably benign Het
Alkbh2 T C 5: 114,123,953 K239E possibly damaging Het
Ankmy1 A T 1: 92,899,568 C87* probably null Het
Apob A G 12: 7,989,191 I461V probably damaging Het
Arap1 C T 7: 101,384,914 P188S possibly damaging Het
Atp12a G A 14: 56,368,413 E64K probably damaging Het
Brca1 A T 11: 101,525,366 H647Q possibly damaging Het
Cachd1 A G 4: 100,983,301 probably benign Het
Cep57 A T 9: 13,808,743 V429D possibly damaging Het
Dip2a T C 10: 76,292,432 probably benign Het
Dmxl2 A T 9: 54,446,412 N757K probably damaging Het
Dock7 G A 4: 98,945,195 T1953I possibly damaging Het
Ebf3 T C 7: 137,225,203 T111A probably damaging Het
Ercc4 T C 16: 13,130,146 I319T probably damaging Het
Fat1 T C 8: 45,033,326 probably benign Het
Gucy2g C T 19: 55,210,284 W809* probably null Het
Hhipl1 A G 12: 108,327,721 K629E probably benign Het
Hmbox1 A T 14: 64,896,774 S126T probably benign Het
Htr1a A G 13: 105,444,324 N24S probably benign Het
Htra3 T A 5: 35,668,356 I185F probably damaging Het
Impg1 C T 9: 80,381,741 D345N probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kdm7a A G 6: 39,147,194 V720A probably benign Het
Kirrel3 A G 9: 35,000,997 D212G possibly damaging Het
Lgals3bp A T 11: 118,393,020 *139K probably null Het
Lrp11 T A 10: 7,590,296 V82D probably benign Het
Mcf2l T C 8: 13,001,964 Y425H probably benign Het
Micalcl T C 7: 112,380,417 S108P probably damaging Het
Ms4a6c C T 19: 11,471,142 T13M probably benign Het
Naip2 C A 13: 100,179,385 V296F probably damaging Het
Olfr586 A G 7: 103,122,010 V254A possibly damaging Het
Olfr716 T A 7: 107,148,087 F257Y possibly damaging Het
Olfr869 T A 9: 20,137,538 C141S probably damaging Het
P3h2 T C 16: 25,997,248 M172V probably benign Het
Pcolce2 T G 9: 95,670,034 N73K probably benign Het
Pla2g4d A G 2: 120,280,617 probably null Het
Ppfia3 A G 7: 45,347,722 probably benign Het
Ptprcap A G 19: 4,156,464 D182G possibly damaging Het
Rabgap1 T C 2: 37,560,469 probably benign Het
Rpain G A 11: 70,975,041 probably null Het
Sdk1 C T 5: 142,161,875 T1754I probably damaging Het
Stag1 T A 9: 100,796,827 L267Q probably damaging Het
Tex9 T C 9: 72,484,092 T92A probably benign Het
Trpa1 T A 1: 14,898,163 I460F possibly damaging Het
Ttn A T 2: 76,950,156 Y1084N probably damaging Het
Utp6 A G 11: 79,941,868 probably benign Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Other mutations in Mfn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02313:Mfn2 APN 4 147885490 missense probably damaging 1.00
IGL03236:Mfn2 APN 4 147882105 missense probably damaging 1.00
milkshake UTSW 4 147887452 missense probably benign 0.12
R0066:Mfn2 UTSW 4 147885445 unclassified probably benign
R0066:Mfn2 UTSW 4 147885445 unclassified probably benign
R0326:Mfn2 UTSW 4 147883288 missense probably damaging 1.00
R0376:Mfn2 UTSW 4 147885526 missense probably benign 0.24
R0564:Mfn2 UTSW 4 147883255 missense probably damaging 1.00
R1595:Mfn2 UTSW 4 147894696 missense probably benign 0.08
R2105:Mfn2 UTSW 4 147888705 nonsense probably null
R2260:Mfn2 UTSW 4 147894606 nonsense probably null
R4544:Mfn2 UTSW 4 147887452 missense probably benign 0.12
R4546:Mfn2 UTSW 4 147887452 missense probably benign 0.12
R4561:Mfn2 UTSW 4 147877035 missense probably damaging 1.00
R5151:Mfn2 UTSW 4 147886328 missense probably benign 0.10
R5355:Mfn2 UTSW 4 147894578 missense probably damaging 1.00
R6645:Mfn2 UTSW 4 147894612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCCATGATGCACCAGGGAAAG -3'
(R):5'- GGTTTGGGAAGGTGACCTGTCAAC -3'

Sequencing Primer
(F):5'- CTGATCACTGTAGCCTAGCAAGG -3'
(R):5'- GAAGGTGACCTGTCAACCAGTC -3'
Posted On2013-11-07