Incidental Mutation 'R0962:Gucy2g'
ID81329
Institutional Source Beutler Lab
Gene Symbol Gucy2g
Ensembl Gene ENSMUSG00000055523
Gene Nameguanylate cyclase 2g
SynonymsGC-G, 2410077I05Rik
MMRRC Submission 039091-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0962 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location55198297-55241236 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 55210284 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Stop codon at position 809 (W809*)
Ref Sequence ENSEMBL: ENSMUSP00000068253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069183]
Predicted Effect probably null
Transcript: ENSMUST00000069183
AA Change: W809*
SMART Domains Protein: ENSMUSP00000068253
Gene: ENSMUSG00000055523
AA Change: W809*

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
Pfam:ANF_receptor 65 416 5.2e-36 PFAM
low complexity region 471 487 N/A INTRINSIC
Pfam:Pkinase 574 826 2e-26 PFAM
Pfam:Pkinase_Tyr 577 826 6e-35 PFAM
CYCc 865 1059 6.42e-96 SMART
Meta Mutation Damage Score 0.6256 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.3%
  • 10x: 97.9%
  • 20x: 96.0%
Validation Efficiency 100% (56/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no gross abnormalities and are protected against acute ischemia induced renal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik T C 5: 98,566,561 probably benign Het
Acaca G A 11: 84,311,303 A196T probably damaging Het
Adamtsl4 T A 3: 95,684,488 R97* probably null Het
Adgrv1 T C 13: 81,405,346 I5470V probably benign Het
Afg3l2 T C 18: 67,405,427 T754A possibly damaging Het
Agfg1 T C 1: 82,886,396 F395S probably damaging Het
Ahnak A G 19: 9,012,848 probably benign Het
Alkbh2 T C 5: 114,123,953 K239E possibly damaging Het
Ankmy1 A T 1: 92,899,568 C87* probably null Het
Apob A G 12: 7,989,191 I461V probably damaging Het
Arap1 C T 7: 101,384,914 P188S possibly damaging Het
Atp12a G A 14: 56,368,413 E64K probably damaging Het
Brca1 A T 11: 101,525,366 H647Q possibly damaging Het
Cachd1 A G 4: 100,983,301 probably benign Het
Cep57 A T 9: 13,808,743 V429D possibly damaging Het
Dip2a T C 10: 76,292,432 probably benign Het
Dmxl2 A T 9: 54,446,412 N757K probably damaging Het
Dock7 G A 4: 98,945,195 T1953I possibly damaging Het
Ebf3 T C 7: 137,225,203 T111A probably damaging Het
Ercc4 T C 16: 13,130,146 I319T probably damaging Het
Fat1 T C 8: 45,033,326 probably benign Het
Hhipl1 A G 12: 108,327,721 K629E probably benign Het
Hmbox1 A T 14: 64,896,774 S126T probably benign Het
Htr1a A G 13: 105,444,324 N24S probably benign Het
Htra3 T A 5: 35,668,356 I185F probably damaging Het
Impg1 C T 9: 80,381,741 D345N probably benign Het
Iqca C A 1: 90,142,731 G133V probably null Het
Kdm7a A G 6: 39,147,194 V720A probably benign Het
Kirrel3 A G 9: 35,000,997 D212G possibly damaging Het
Lgals3bp A T 11: 118,393,020 *139K probably null Het
Lrp11 T A 10: 7,590,296 V82D probably benign Het
Mcf2l T C 8: 13,001,964 Y425H probably benign Het
Mfn2 T C 4: 147,882,201 N511S probably benign Het
Micalcl T C 7: 112,380,417 S108P probably damaging Het
Ms4a6c C T 19: 11,471,142 T13M probably benign Het
Naip2 C A 13: 100,179,385 V296F probably damaging Het
Olfr586 A G 7: 103,122,010 V254A possibly damaging Het
Olfr716 T A 7: 107,148,087 F257Y possibly damaging Het
Olfr869 T A 9: 20,137,538 C141S probably damaging Het
P3h2 T C 16: 25,997,248 M172V probably benign Het
Pcolce2 T G 9: 95,670,034 N73K probably benign Het
Pla2g4d A G 2: 120,280,617 probably null Het
Ppfia3 A G 7: 45,347,722 probably benign Het
Ptprcap A G 19: 4,156,464 D182G possibly damaging Het
Rabgap1 T C 2: 37,560,469 probably benign Het
Rpain G A 11: 70,975,041 probably null Het
Sdk1 C T 5: 142,161,875 T1754I probably damaging Het
Stag1 T A 9: 100,796,827 L267Q probably damaging Het
Tex9 T C 9: 72,484,092 T92A probably benign Het
Trpa1 T A 1: 14,898,163 I460F possibly damaging Het
Ttn A T 2: 76,950,156 Y1084N probably damaging Het
Utp6 A G 11: 79,941,868 probably benign Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Other mutations in Gucy2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Gucy2g APN 19 55233103 missense probably benign 0.01
IGL01954:Gucy2g APN 19 55198691 missense probably benign 0.01
IGL01969:Gucy2g APN 19 55227438 missense probably benign 0.00
IGL02164:Gucy2g APN 19 55238023 missense probably benign
IGL02534:Gucy2g APN 19 55241068 missense probably damaging 1.00
IGL02667:Gucy2g APN 19 55206177 missense possibly damaging 0.64
IGL02755:Gucy2g APN 19 55210354 missense probably benign 0.10
IGL03187:Gucy2g APN 19 55231052 missense possibly damaging 0.91
IGL03354:Gucy2g APN 19 55233080 missense possibly damaging 0.95
PIT4366001:Gucy2g UTSW 19 55237782 missense probably null 0.51
R0040:Gucy2g UTSW 19 55217302 missense possibly damaging 0.73
R0126:Gucy2g UTSW 19 55241166 missense probably benign
R0318:Gucy2g UTSW 19 55237798 missense probably benign 0.00
R0576:Gucy2g UTSW 19 55198770 missense probably damaging 1.00
R0604:Gucy2g UTSW 19 55203087 missense probably benign 0.00
R1348:Gucy2g UTSW 19 55222906 missense possibly damaging 0.68
R1458:Gucy2g UTSW 19 55215036 splice site probably benign
R1693:Gucy2g UTSW 19 55222926 missense probably damaging 1.00
R1795:Gucy2g UTSW 19 55199541 missense probably damaging 1.00
R1804:Gucy2g UTSW 19 55210309 missense probably benign 0.34
R1830:Gucy2g UTSW 19 55222930 missense possibly damaging 0.94
R1902:Gucy2g UTSW 19 55210237 missense probably benign 0.20
R1927:Gucy2g UTSW 19 55237759 missense probably benign 0.02
R1969:Gucy2g UTSW 19 55222896 missense possibly damaging 0.90
R1969:Gucy2g UTSW 19 55233053 missense probably benign 0.42
R2071:Gucy2g UTSW 19 55222340 missense possibly damaging 0.72
R2842:Gucy2g UTSW 19 55240947 missense probably damaging 1.00
R2971:Gucy2g UTSW 19 55210276 missense probably damaging 1.00
R4202:Gucy2g UTSW 19 55229769 missense possibly damaging 0.96
R4405:Gucy2g UTSW 19 55237837 missense probably benign 0.08
R4407:Gucy2g UTSW 19 55237837 missense probably benign 0.08
R4614:Gucy2g UTSW 19 55202147 nonsense probably null
R4671:Gucy2g UTSW 19 55238068 missense probably damaging 1.00
R4684:Gucy2g UTSW 19 55206256 missense probably damaging 1.00
R4837:Gucy2g UTSW 19 55226053 missense probably benign
R4969:Gucy2g UTSW 19 55226013 missense probably benign
R5050:Gucy2g UTSW 19 55240935 missense probably benign 0.05
R5059:Gucy2g UTSW 19 55226071 missense probably benign 0.00
R5070:Gucy2g UTSW 19 55229787 missense probably damaging 0.98
R5288:Gucy2g UTSW 19 55215116 missense probably damaging 1.00
R5384:Gucy2g UTSW 19 55215116 missense probably damaging 1.00
R5386:Gucy2g UTSW 19 55215116 missense probably damaging 1.00
R5497:Gucy2g UTSW 19 55198701 missense probably benign 0.00
R5531:Gucy2g UTSW 19 55241140 missense probably benign 0.24
R5536:Gucy2g UTSW 19 55237927 missense probably benign 0.05
R5679:Gucy2g UTSW 19 55231079 missense possibly damaging 0.87
R5715:Gucy2g UTSW 19 55233155 missense possibly damaging 0.93
R5941:Gucy2g UTSW 19 55215131 missense probably damaging 1.00
R6250:Gucy2g UTSW 19 55217424 missense probably damaging 0.99
R6288:Gucy2g UTSW 19 55227513 missense probably benign 0.01
R6378:Gucy2g UTSW 19 55240945 missense probably benign 0.00
R6605:Gucy2g UTSW 19 55241028 missense probably damaging 1.00
R7020:Gucy2g UTSW 19 55233050 missense probably damaging 0.98
R7064:Gucy2g UTSW 19 55210332 missense probably benign 0.01
R7078:Gucy2g UTSW 19 55241151 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGAGCCAGCGTGTAGAACTTTG -3'
(R):5'- TTTAAGCTGGAGGATGCCGTCAC -3'

Sequencing Primer
(F):5'- ggagagaagagagaggaggg -3'
(R):5'- GGATGCCGTCACTATTTAGACAG -3'
Posted On2013-11-07