Incidental Mutation 'R0940:Zkscan1'
ID81389
Institutional Source Beutler Lab
Gene Symbol Zkscan1
Ensembl Gene ENSMUSG00000029729
Gene Namezinc finger with KRAB and SCAN domains 1
Synonyms9230118B16Rik, KOX18, 9130423L19Rik, 5930429A01Rik
MMRRC Submission 039079-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R0940 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location138085084-138107822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 138093170 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 55 (F55S)
Ref Sequence ENSEMBL: ENSMUSP00000106588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019660] [ENSMUST00000066617] [ENSMUST00000110962] [ENSMUST00000110963]
Predicted Effect probably damaging
Transcript: ENSMUST00000019660
AA Change: F55S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019660
Gene: ENSMUSG00000029729
AA Change: F55S

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
SCAN 52 162 1.5e-75 SMART
KRAB 225 285 5.7e-8 SMART
low complexity region 300 314 N/A INTRINSIC
low complexity region 316 337 N/A INTRINSIC
ZnF_C2H2 375 397 1.3e-5 SMART
ZnF_C2H2 403 425 7.3e-6 SMART
ZnF_C2H2 431 453 5.6e-6 SMART
ZnF_C2H2 459 481 4e-7 SMART
ZnF_C2H2 487 509 3.8e-6 SMART
ZnF_C2H2 515 537 5.7e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000066617
AA Change: F55S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000068480
Gene: ENSMUSG00000029729
AA Change: F55S

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
SCAN 52 162 4.62e-73 SMART
low complexity region 227 241 N/A INTRINSIC
low complexity region 243 264 N/A INTRINSIC
ZnF_C2H2 302 324 2.95e-3 SMART
ZnF_C2H2 330 352 1.69e-3 SMART
ZnF_C2H2 358 380 1.28e-3 SMART
ZnF_C2H2 386 408 9.22e-5 SMART
ZnF_C2H2 414 436 9.08e-4 SMART
ZnF_C2H2 442 464 1.28e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110962
AA Change: F55S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106587
Gene: ENSMUSG00000029729
AA Change: F55S

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
SCAN 52 162 4.62e-73 SMART
low complexity region 227 241 N/A INTRINSIC
low complexity region 243 264 N/A INTRINSIC
ZnF_C2H2 302 324 2.95e-3 SMART
ZnF_C2H2 330 352 1.69e-3 SMART
ZnF_C2H2 358 380 1.28e-3 SMART
ZnF_C2H2 386 408 9.22e-5 SMART
ZnF_C2H2 414 436 9.08e-4 SMART
ZnF_C2H2 442 464 1.28e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110963
AA Change: F55S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106588
Gene: ENSMUSG00000029729
AA Change: F55S

DomainStartEndE-ValueType
low complexity region 19 35 N/A INTRINSIC
SCAN 52 162 4.62e-73 SMART
low complexity region 227 241 N/A INTRINSIC
low complexity region 243 264 N/A INTRINSIC
ZnF_C2H2 302 324 2.95e-3 SMART
ZnF_C2H2 330 352 1.69e-3 SMART
ZnF_C2H2 358 380 1.28e-3 SMART
ZnF_C2H2 386 408 9.22e-5 SMART
ZnF_C2H2 414 436 9.08e-4 SMART
ZnF_C2H2 442 464 1.28e-3 SMART
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 99.1%
  • 10x: 98.0%
  • 20x: 96.7%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Kruppel C2H2-type zinc-finger family of proteins. This encoded protein may function as a transcription factor that regulates the expression of GABA type-A receptors in the brain. Transcripts from this gene have been shown to form stable and abundant circular RNAs. Elevated expression of this gene has been observed in gastric cancer and the encoded protein may stimulate migration and invasion of human gastric cancer cells. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810064F22Rik C T 9: 22,208,071 noncoding transcript Het
2610021A01Rik T G 7: 41,626,434 I520M probably damaging Het
Ackr4 A G 9: 104,099,632 F39L probably damaging Het
Adgre5 C T 8: 83,733,497 S92N probably damaging Het
Adrb2 T C 18: 62,179,691 D21G probably benign Het
AI464131 A G 4: 41,497,996 Y545H probably damaging Het
Akr1c6 G A 13: 4,436,373 E60K probably benign Het
Bcl7c T A 7: 127,707,331 N96I possibly damaging Het
Brca1 A T 11: 101,532,143 S106R possibly damaging Het
C6 A T 15: 4,735,235 T138S probably benign Het
Cul3 T C 1: 80,322,847 probably benign Het
Dnah8 T A 17: 30,803,243 M3939K probably damaging Het
Dock4 T A 12: 40,631,627 probably benign Het
Dsc2 T G 18: 20,050,059 T101P probably damaging Het
Dynlt1b T C 17: 6,430,250 probably benign Het
E330013P04Rik A G 19: 60,161,922 noncoding transcript Het
Fam160a1 A G 3: 85,665,490 V952A possibly damaging Het
Fggy A G 4: 95,697,001 E39G probably benign Het
Fmo6 A T 1: 162,926,226 C116S probably benign Het
Gadd45a A G 6: 67,036,829 I44T possibly damaging Het
Gmps A G 3: 63,976,322 probably benign Het
Gnmt A G 17: 46,726,345 L171P probably damaging Het
Hnrnpm G A 17: 33,650,002 R523C probably damaging Het
Inpp5a T C 7: 139,525,738 Y202H probably damaging Het
Kank3 C T 17: 33,817,476 S106F probably damaging Het
Lmcd1 A G 6: 112,328,697 D253G probably benign Het
Lrrk2 A T 15: 91,729,081 I803F possibly damaging Het
Mybpc2 T C 7: 44,506,887 K834R probably benign Het
Mycbp2 A T 14: 103,262,693 probably benign Het
Myh4 A T 11: 67,242,863 N243Y probably damaging Het
Nfatc1 C T 18: 80,635,895 M759I probably benign Het
Nipal4 A G 11: 46,150,312 I352T possibly damaging Het
Nomo1 A G 7: 46,033,905 E25G possibly damaging Het
Olfr1221 T A 2: 89,112,075 I146L probably benign Het
Olfr128 A G 17: 37,923,700 I45V probably damaging Het
Olfr1408 A G 1: 173,130,453 S255P probably benign Het
Olfr392 T C 11: 73,814,224 N286S probably damaging Het
Olfr490 T C 7: 108,287,057 D23G probably benign Het
Olfr525 T C 7: 140,323,152 I151T probably benign Het
Pabpn1l A G 8: 122,622,444 V78A probably benign Het
Pde6b T A 5: 108,420,337 I327N possibly damaging Het
Phrf1 T C 7: 141,254,855 probably benign Het
Pkm C T 9: 59,668,535 probably benign Het
Plxna2 G A 1: 194,800,555 V1519I probably benign Het
Ppp2cb T C 8: 33,615,661 probably null Het
Prickle2 A G 6: 92,411,003 Y473H probably benign Het
Prpf3 A G 3: 95,844,223 W389R probably damaging Het
Psme4 G A 11: 30,815,264 E544K possibly damaging Het
Relb A T 7: 19,611,842 D395E probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf213 A G 11: 119,416,563 N683S probably benign Het
Rtel1 T C 2: 181,322,803 C102R probably benign Het
Sel1l3 C T 5: 53,144,037 probably benign Het
Slc8a2 A G 7: 16,144,962 T458A probably benign Het
Smc3 T A 19: 53,640,909 M931K probably benign Het
Sorbs2 T C 8: 45,796,502 V795A probably benign Het
Tgm3 A G 2: 130,012,406 S2G probably benign Het
Tpbpa T C 13: 60,940,053 T75A probably damaging Het
Trub1 A G 19: 57,485,063 probably benign Het
Uggt2 A G 14: 119,091,192 probably null Het
Ugt2a3 A G 5: 87,327,206 V393A possibly damaging Het
Vav3 T A 3: 109,562,835 M532K possibly damaging Het
Zfp616 A T 11: 74,085,024 K706N probably damaging Het
Other mutations in Zkscan1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03172:Zkscan1 APN 5 138094002 missense probably benign 0.00
R0078:Zkscan1 UTSW 5 138093101 missense probably damaging 1.00
R0206:Zkscan1 UTSW 5 138101186 missense probably damaging 1.00
R0206:Zkscan1 UTSW 5 138101186 missense probably damaging 1.00
R0324:Zkscan1 UTSW 5 138097523 missense probably damaging 1.00
R0503:Zkscan1 UTSW 5 138093326 missense probably damaging 0.99
R1879:Zkscan1 UTSW 5 138097148 missense probably damaging 1.00
R1926:Zkscan1 UTSW 5 138101363 missense probably benign 0.33
R3749:Zkscan1 UTSW 5 138101441 missense probably damaging 0.99
R5045:Zkscan1 UTSW 5 138100920 missense probably damaging 1.00
R5391:Zkscan1 UTSW 5 138097101 missense probably benign
R6339:Zkscan1 UTSW 5 138093305 missense probably damaging 1.00
R6936:Zkscan1 UTSW 5 138093305 missense probably damaging 1.00
R7178:Zkscan1 UTSW 5 138100930 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGAGCCTGAATGATGACTGCTGAG -3'
(R):5'- CTGCTGTCCCGATAGATCAAGTTCC -3'

Sequencing Primer
(F):5'- GTCAAGGGAAACCACAGGTCTATC -3'
(R):5'- TCTAGAAGAGTCACGGCCTC -3'
Posted On2013-11-07