Incidental Mutation 'R0964:Alppl2'
ID81436
Institutional Source Beutler Lab
Gene Symbol Alppl2
Ensembl Gene ENSMUSG00000026246
Gene Namealkaline phosphatase, placental-like 2
SynonymsAkp5, D1Ertd816e
MMRRC Submission 039093-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R0964 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location87086694-87089928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87087724 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 372 (V372I)
Ref Sequence ENSEMBL: ENSMUSP00000139887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027455] [ENSMUST00000188310]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027455
AA Change: V372I

PolyPhen 2 Score 0.727 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000027455
Gene: ENSMUSG00000026246
AA Change: V372I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 33 45 N/A INTRINSIC
alkPPc 52 487 2.24e-250 SMART
low complexity region 512 527 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186823
Predicted Effect possibly damaging
Transcript: ENSMUST00000188310
AA Change: V372I

PolyPhen 2 Score 0.727 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139887
Gene: ENSMUSG00000026246
AA Change: V372I

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 33 45 N/A INTRINSIC
alkPPc 52 487 2.24e-250 SMART
low complexity region 512 527 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190082
Meta Mutation Damage Score 0.042 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] There are at least four distinct but related alkaline phosphatases: intestinal, placental, placental-like, and liver/bone/kidney (tissue non-specific). The product of this gene is a membrane bound glycosylated enzyme, localized to testis, thymus and certain germ cell tumors, that is closely related to both the placental and intestinal forms of alkaline phosphatase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit strain background-dependent differences in the timing of preimplantation cleavage and development, embryo survival, gestational length and litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Acacb A T 5: 114,229,752 M1604L possibly damaging Het
Acpp A G 9: 104,326,975 V40A possibly damaging Het
Adgrl1 T C 8: 83,934,412 probably benign Het
Apol8 C T 15: 77,749,611 S255N probably benign Het
Atp8b4 A T 2: 126,337,493 F973I probably damaging Het
Bbs4 A G 9: 59,322,976 *150Q probably null Het
Cacna1h A T 17: 25,378,775 probably benign Het
Ccser2 C T 14: 36,909,008 probably benign Het
Chd9 A G 8: 91,015,204 E1607G probably benign Het
Clca4b A G 3: 144,915,576 I579T probably benign Het
Col20a1 T A 2: 180,984,485 probably benign Het
Creg2 T C 1: 39,624,976 I205V probably benign Het
Cyr61 C A 3: 145,647,748 C353F probably damaging Het
Ddx24 C T 12: 103,423,907 R275H probably damaging Het
Dip2c G A 13: 9,568,663 A579T probably benign Het
Dnah3 T C 7: 119,952,739 probably benign Het
Dnah8 G A 17: 30,673,920 probably null Het
Gckr T C 5: 31,326,915 probably benign Het
Gpbp1l1 A G 4: 116,581,239 probably benign Het
Hmcn2 A G 2: 31,391,511 T1913A probably benign Het
Lmo7 T C 14: 101,920,567 probably benign Het
Meioc G A 11: 102,680,031 V863I probably damaging Het
Myh1 A G 11: 67,205,925 I341V probably benign Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Myh13 A G 11: 67,345,002 T664A probably benign Het
Myo3b A C 2: 70,426,849 D1269A probably damaging Het
Nckap1 A G 2: 80,547,899 probably null Het
Nr3c2 A G 8: 76,908,668 probably null Het
Nxpe5 T C 5: 138,239,924 S249P probably damaging Het
Olfr1008 A G 2: 85,690,365 N312S probably benign Het
Olfr460 T C 6: 40,572,205 V273A probably benign Het
Olfr67 C T 7: 103,787,397 M293I probably benign Het
Pitpnm3 G A 11: 72,058,470 T675I probably damaging Het
Plekhm1 C A 11: 103,395,082 E176* probably null Het
Prdm11 C A 2: 92,989,222 probably benign Het
Prodh2 C A 7: 30,506,281 R218S probably damaging Het
Rps15a T C 7: 118,114,837 D54G probably benign Het
Sbno2 G T 10: 80,084,259 T46N possibly damaging Het
Sdk2 A G 11: 113,806,417 probably benign Het
Sema3c T C 5: 17,721,909 F567L probably damaging Het
Slc36a1 A G 11: 55,225,954 probably benign Het
Spaca6 A T 17: 17,838,391 E284V possibly damaging Het
Srsf3 C A 17: 29,036,438 L66I probably damaging Het
Srsf3 T A 17: 29,036,439 L66Q probably damaging Het
Syne1 T C 10: 5,043,652 T8363A possibly damaging Het
Trmt1 T A 8: 84,696,852 L298Q probably damaging Het
Uba6 T C 5: 86,119,401 I923V possibly damaging Het
Uhrf1bp1 A T 17: 27,887,178 T893S probably damaging Het
Vmn2r106 G A 17: 20,267,597 H847Y probably benign Het
Vmn2r15 T C 5: 109,297,535 T8A probably benign Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Zbtb41 T G 1: 139,439,031 F583V probably damaging Het
Zfp938 T A 10: 82,225,419 I456F probably benign Het
Other mutations in Alppl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Alppl2 APN 1 87088812 missense probably damaging 1.00
IGL02404:Alppl2 APN 1 87088863 missense possibly damaging 0.79
I2288:Alppl2 UTSW 1 87088176 missense possibly damaging 0.86
R0194:Alppl2 UTSW 1 87088743 missense probably damaging 1.00
R0305:Alppl2 UTSW 1 87089602 missense probably benign 0.28
R0631:Alppl2 UTSW 1 87089373 missense probably damaging 1.00
R1976:Alppl2 UTSW 1 87088741 missense probably damaging 1.00
R2140:Alppl2 UTSW 1 87087697 missense probably benign 0.21
R3796:Alppl2 UTSW 1 87088354 critical splice donor site probably null
R4672:Alppl2 UTSW 1 87089465 intron probably benign
R5020:Alppl2 UTSW 1 87089709 missense probably benign
R5513:Alppl2 UTSW 1 87087338 missense probably benign 0.02
R6258:Alppl2 UTSW 1 87088462 missense probably damaging 1.00
R6260:Alppl2 UTSW 1 87088462 missense probably damaging 1.00
R7026:Alppl2 UTSW 1 87089698 critical splice donor site probably null
R7038:Alppl2 UTSW 1 87089111 missense probably damaging 1.00
R7322:Alppl2 UTSW 1 87087462 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- AGGACCGTTGCCGTATAGTATCGAG -3'
(R):5'- GCAGGAACCCCAAAGGCTTCTATC -3'

Sequencing Primer
(F):5'- GTAAAGGATTTGCCATCCTCAGC -3'
(R):5'- CAAAGGCTTCTATCTCTTTGTGG -3'
Posted On2013-11-07