Incidental Mutation 'R0964:Vmn2r15'
ID81465
Institutional Source Beutler Lab
Gene Symbol Vmn2r15
Ensembl Gene ENSMUSG00000091375
Gene Namevomeronasal 2, receptor 15
SynonymsEG211223
MMRRC Submission 039093-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R0964 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location109286269-109297556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109297535 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 8 (T8A)
Ref Sequence ENSEMBL: ENSMUSP00000128333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167133]
Predicted Effect probably benign
Transcript: ENSMUST00000167133
AA Change: T8A

PolyPhen 2 Score 0.345 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128333
Gene: ENSMUSG00000091375
AA Change: T8A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 75 472 1e-29 PFAM
Pfam:NCD3G 514 568 5.8e-18 PFAM
Pfam:7tm_3 601 836 9.1e-55 PFAM
Meta Mutation Damage Score 0.1264 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Acacb A T 5: 114,229,752 M1604L possibly damaging Het
Acpp A G 9: 104,326,975 V40A possibly damaging Het
Adgrl1 T C 8: 83,934,412 probably benign Het
Alppl2 C T 1: 87,087,724 V372I possibly damaging Het
Apol8 C T 15: 77,749,611 S255N probably benign Het
Atp8b4 A T 2: 126,337,493 F973I probably damaging Het
Bbs4 A G 9: 59,322,976 *150Q probably null Het
Cacna1h A T 17: 25,378,775 probably benign Het
Ccser2 C T 14: 36,909,008 probably benign Het
Chd9 A G 8: 91,015,204 E1607G probably benign Het
Clca4b A G 3: 144,915,576 I579T probably benign Het
Col20a1 T A 2: 180,984,485 probably benign Het
Creg2 T C 1: 39,624,976 I205V probably benign Het
Cyr61 C A 3: 145,647,748 C353F probably damaging Het
Ddx24 C T 12: 103,423,907 R275H probably damaging Het
Dip2c G A 13: 9,568,663 A579T probably benign Het
Dnah3 T C 7: 119,952,739 probably benign Het
Dnah8 G A 17: 30,673,920 probably null Het
Gckr T C 5: 31,326,915 probably benign Het
Gpbp1l1 A G 4: 116,581,239 probably benign Het
Hmcn2 A G 2: 31,391,511 T1913A probably benign Het
Lmo7 T C 14: 101,920,567 probably benign Het
Meioc G A 11: 102,680,031 V863I probably damaging Het
Myh1 A G 11: 67,205,925 I341V probably benign Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Myh13 A G 11: 67,345,002 T664A probably benign Het
Myo3b A C 2: 70,426,849 D1269A probably damaging Het
Nckap1 A G 2: 80,547,899 probably null Het
Nr3c2 A G 8: 76,908,668 probably null Het
Nxpe5 T C 5: 138,239,924 S249P probably damaging Het
Olfr1008 A G 2: 85,690,365 N312S probably benign Het
Olfr460 T C 6: 40,572,205 V273A probably benign Het
Olfr67 C T 7: 103,787,397 M293I probably benign Het
Pitpnm3 G A 11: 72,058,470 T675I probably damaging Het
Plekhm1 C A 11: 103,395,082 E176* probably null Het
Prdm11 C A 2: 92,989,222 probably benign Het
Prodh2 C A 7: 30,506,281 R218S probably damaging Het
Rps15a T C 7: 118,114,837 D54G probably benign Het
Sbno2 G T 10: 80,084,259 T46N possibly damaging Het
Sdk2 A G 11: 113,806,417 probably benign Het
Sema3c T C 5: 17,721,909 F567L probably damaging Het
Slc36a1 A G 11: 55,225,954 probably benign Het
Spaca6 A T 17: 17,838,391 E284V possibly damaging Het
Srsf3 C A 17: 29,036,438 L66I probably damaging Het
Srsf3 T A 17: 29,036,439 L66Q probably damaging Het
Syne1 T C 10: 5,043,652 T8363A possibly damaging Het
Trmt1 T A 8: 84,696,852 L298Q probably damaging Het
Uba6 T C 5: 86,119,401 I923V possibly damaging Het
Uhrf1bp1 A T 17: 27,887,178 T893S probably damaging Het
Vmn2r106 G A 17: 20,267,597 H847Y probably benign Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Zbtb41 T G 1: 139,439,031 F583V probably damaging Het
Zfp938 T A 10: 82,225,419 I456F probably benign Het
Other mutations in Vmn2r15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Vmn2r15 APN 5 109286736 missense possibly damaging 0.70
IGL01367:Vmn2r15 APN 5 109293209 missense probably damaging 0.99
IGL01844:Vmn2r15 APN 5 109286269 makesense probably null
IGL02190:Vmn2r15 APN 5 109293374 missense probably damaging 1.00
IGL02754:Vmn2r15 APN 5 109293268 nonsense probably null
IGL02797:Vmn2r15 APN 5 109297384 missense probably benign 0.18
IGL03301:Vmn2r15 APN 5 109297355 critical splice donor site probably null
IGL03407:Vmn2r15 APN 5 109286319 nonsense probably null
PIT4445001:Vmn2r15 UTSW 5 109287142 missense probably damaging 0.99
PIT4520001:Vmn2r15 UTSW 5 109287005 missense probably damaging 1.00
R0038:Vmn2r15 UTSW 5 109293144 missense possibly damaging 0.46
R0111:Vmn2r15 UTSW 5 109287156 missense possibly damaging 0.56
R0379:Vmn2r15 UTSW 5 109286478 missense probably damaging 1.00
R0427:Vmn2r15 UTSW 5 109287087 missense probably damaging 1.00
R0639:Vmn2r15 UTSW 5 109293015 missense probably benign 0.22
R1147:Vmn2r15 UTSW 5 109293206 missense probably damaging 1.00
R1147:Vmn2r15 UTSW 5 109293206 missense probably damaging 1.00
R1232:Vmn2r15 UTSW 5 109293302 missense probably benign 0.39
R1241:Vmn2r15 UTSW 5 109292904 missense probably damaging 1.00
R1244:Vmn2r15 UTSW 5 109293226 nonsense probably null
R1394:Vmn2r15 UTSW 5 109294148 missense probably benign 0.44
R1395:Vmn2r15 UTSW 5 109294148 missense probably benign 0.44
R1423:Vmn2r15 UTSW 5 109293227 missense probably damaging 1.00
R1439:Vmn2r15 UTSW 5 109294087 missense probably damaging 1.00
R1513:Vmn2r15 UTSW 5 109293329 missense probably damaging 1.00
R1777:Vmn2r15 UTSW 5 109294270 missense possibly damaging 0.79
R1844:Vmn2r15 UTSW 5 109286994 nonsense probably null
R2072:Vmn2r15 UTSW 5 109286753 missense possibly damaging 0.65
R2074:Vmn2r15 UTSW 5 109286753 missense possibly damaging 0.65
R2122:Vmn2r15 UTSW 5 109286456 missense probably damaging 1.00
R2208:Vmn2r15 UTSW 5 109297443 missense possibly damaging 0.64
R2268:Vmn2r15 UTSW 5 109293207 missense probably benign 0.31
R2831:Vmn2r15 UTSW 5 109286592 missense probably damaging 1.00
R3848:Vmn2r15 UTSW 5 109297446 missense probably benign 0.00
R4058:Vmn2r15 UTSW 5 109293446 missense probably damaging 0.99
R4615:Vmn2r15 UTSW 5 109293482 missense possibly damaging 0.91
R4663:Vmn2r15 UTSW 5 109294074 missense probably benign
R4681:Vmn2r15 UTSW 5 109286622 missense probably damaging 0.97
R4751:Vmn2r15 UTSW 5 109286754 missense probably benign 0.01
R5095:Vmn2r15 UTSW 5 109288451 critical splice acceptor site probably null
R5300:Vmn2r15 UTSW 5 109294108 missense probably damaging 0.99
R5309:Vmn2r15 UTSW 5 109293090 missense probably damaging 0.99
R5335:Vmn2r15 UTSW 5 109286807 missense probably damaging 0.99
R5421:Vmn2r15 UTSW 5 109286535 missense probably damaging 1.00
R5805:Vmn2r15 UTSW 5 109286940 missense possibly damaging 0.88
R6280:Vmn2r15 UTSW 5 109293425 missense possibly damaging 0.65
R6324:Vmn2r15 UTSW 5 109286271 makesense probably null
R6383:Vmn2r15 UTSW 5 109293226 nonsense probably null
R6772:Vmn2r15 UTSW 5 109286372 missense probably damaging 0.99
R6991:Vmn2r15 UTSW 5 109293314 missense probably damaging 1.00
R7194:Vmn2r15 UTSW 5 109292783 missense probably damaging 1.00
R7365:Vmn2r15 UTSW 5 109293239 missense probably benign 0.19
R7365:Vmn2r15 UTSW 5 109297522 missense probably benign 0.15
R7423:Vmn2r15 UTSW 5 109297528 missense probably benign 0.00
R7552:Vmn2r15 UTSW 5 109292908 nonsense probably null
X0065:Vmn2r15 UTSW 5 109293308 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATAGGTCCCTCAACTGCTGCAAG -3'
(R):5'- TGAAATCATGGCACCTGAGGACG -3'

Sequencing Primer
(F):5'- TCAACTGCTGCAAGGAAAAC -3'
(R):5'- TCAGATCTCAGATGTAGAGCCTG -3'
Posted On2013-11-07