Incidental Mutation 'R0964:Olfr460'
ID81472
Institutional Source Beutler Lab
Gene Symbol Olfr460
Ensembl Gene ENSMUSG00000045514
Gene Nameolfactory receptor 460
SynonymsGA_x6K02T2P3E9-6947292-6946348, MOR120-2
MMRRC Submission 039093-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R0964 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location40569487-40574343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40572205 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 273 (V273A)
Ref Sequence ENSEMBL: ENSMUSP00000151187 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051540] [ENSMUST00000101491] [ENSMUST00000216942]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000031975
Predicted Effect probably benign
Transcript: ENSMUST00000051540
AA Change: V273A

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000054887
Gene: ENSMUSG00000045514
AA Change: V273A

DomainStartEndE-ValueType
Pfam:7tm_4 30 308 3e-44 PFAM
Pfam:7TM_GPCR_Srsx 34 296 3e-5 PFAM
Pfam:7tm_1 40 290 2.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101491
SMART Domains Protein: ENSMUSP00000099030
Gene: ENSMUSG00000029915

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
CLECT 48 161 3.83e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216942
AA Change: V273A

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
Meta Mutation Damage Score 0.266 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Acacb A T 5: 114,229,752 M1604L possibly damaging Het
Acpp A G 9: 104,326,975 V40A possibly damaging Het
Adgrl1 T C 8: 83,934,412 probably benign Het
Alppl2 C T 1: 87,087,724 V372I possibly damaging Het
Apol8 C T 15: 77,749,611 S255N probably benign Het
Atp8b4 A T 2: 126,337,493 F973I probably damaging Het
Bbs4 A G 9: 59,322,976 *150Q probably null Het
Cacna1h A T 17: 25,378,775 probably benign Het
Ccser2 C T 14: 36,909,008 probably benign Het
Chd9 A G 8: 91,015,204 E1607G probably benign Het
Clca4b A G 3: 144,915,576 I579T probably benign Het
Col20a1 T A 2: 180,984,485 probably benign Het
Creg2 T C 1: 39,624,976 I205V probably benign Het
Cyr61 C A 3: 145,647,748 C353F probably damaging Het
Ddx24 C T 12: 103,423,907 R275H probably damaging Het
Dip2c G A 13: 9,568,663 A579T probably benign Het
Dnah3 T C 7: 119,952,739 probably benign Het
Dnah8 G A 17: 30,673,920 probably null Het
Gckr T C 5: 31,326,915 probably benign Het
Gpbp1l1 A G 4: 116,581,239 probably benign Het
Hmcn2 A G 2: 31,391,511 T1913A probably benign Het
Lmo7 T C 14: 101,920,567 probably benign Het
Meioc G A 11: 102,680,031 V863I probably damaging Het
Myh1 A G 11: 67,205,925 I341V probably benign Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Myh13 A G 11: 67,345,002 T664A probably benign Het
Myo3b A C 2: 70,426,849 D1269A probably damaging Het
Nckap1 A G 2: 80,547,899 probably null Het
Nr3c2 A G 8: 76,908,668 probably null Het
Nxpe5 T C 5: 138,239,924 S249P probably damaging Het
Olfr1008 A G 2: 85,690,365 N312S probably benign Het
Olfr67 C T 7: 103,787,397 M293I probably benign Het
Pitpnm3 G A 11: 72,058,470 T675I probably damaging Het
Plekhm1 C A 11: 103,395,082 E176* probably null Het
Prdm11 C A 2: 92,989,222 probably benign Het
Prodh2 C A 7: 30,506,281 R218S probably damaging Het
Rps15a T C 7: 118,114,837 D54G probably benign Het
Sbno2 G T 10: 80,084,259 T46N possibly damaging Het
Sdk2 A G 11: 113,806,417 probably benign Het
Sema3c T C 5: 17,721,909 F567L probably damaging Het
Slc36a1 A G 11: 55,225,954 probably benign Het
Spaca6 A T 17: 17,838,391 E284V possibly damaging Het
Srsf3 C A 17: 29,036,438 L66I probably damaging Het
Srsf3 T A 17: 29,036,439 L66Q probably damaging Het
Syne1 T C 10: 5,043,652 T8363A possibly damaging Het
Trmt1 T A 8: 84,696,852 L298Q probably damaging Het
Uba6 T C 5: 86,119,401 I923V possibly damaging Het
Uhrf1bp1 A T 17: 27,887,178 T893S probably damaging Het
Vmn2r106 G A 17: 20,267,597 H847Y probably benign Het
Vmn2r15 T C 5: 109,297,535 T8A probably benign Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Zbtb41 T G 1: 139,439,031 F583V probably damaging Het
Zfp938 T A 10: 82,225,419 I456F probably benign Het
Other mutations in Olfr460
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Olfr460 APN 6 40571454 missense probably benign 0.01
IGL01599:Olfr460 APN 6 40572252 missense probably damaging 0.99
IGL02168:Olfr460 APN 6 40571383 utr 5 prime probably benign
PIT4280001:Olfr460 UTSW 6 40571716 missense probably damaging 0.98
R1446:Olfr460 UTSW 6 40571899 missense probably benign 0.06
R2925:Olfr460 UTSW 6 40571408 missense probably benign 0.00
R4295:Olfr460 UTSW 6 40572156 missense probably damaging 1.00
R4382:Olfr460 UTSW 6 40572064 missense probably damaging 1.00
R7432:Olfr460 UTSW 6 40572306 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAACAGTCGCACCTGCAACTC -3'
(R):5'- TGTACCTCGGAGATGGTCTTCTCAG -3'

Sequencing Primer
(F):5'- CGAGGCCAGTTGCTCAAATTATC -3'
(R):5'- GAGATGGTCTTCTCAGATTATTCCAG -3'
Posted On2013-11-07