Incidental Mutation 'R0964:4930433I11Rik'
ID81476
Institutional Source Beutler Lab
Gene Symbol 4930433I11Rik
Ensembl Gene ENSMUSG00000091692
Gene NameRIKEN cDNA 4930433I11 gene
SynonymsLOC243944
MMRRC Submission 039093-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R0964 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location40987543-40995435 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40993056 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 141 (T141S)
Ref Sequence ENSEMBL: ENSMUSP00000146117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171664] [ENSMUST00000206529]
Predicted Effect probably benign
Transcript: ENSMUST00000171664
AA Change: T50S

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000131120
Gene: ENSMUSG00000091692
AA Change: T50S

DomainStartEndE-ValueType
Pfam:DUF4629 208 354 2.2e-60 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206360
Predicted Effect probably benign
Transcript: ENSMUST00000206529
AA Change: T141S

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.334 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,229,752 M1604L possibly damaging Het
Acpp A G 9: 104,326,975 V40A possibly damaging Het
Adgrl1 T C 8: 83,934,412 probably benign Het
Alppl2 C T 1: 87,087,724 V372I possibly damaging Het
Apol8 C T 15: 77,749,611 S255N probably benign Het
Atp8b4 A T 2: 126,337,493 F973I probably damaging Het
Bbs4 A G 9: 59,322,976 *150Q probably null Het
Cacna1h A T 17: 25,378,775 probably benign Het
Ccser2 C T 14: 36,909,008 probably benign Het
Chd9 A G 8: 91,015,204 E1607G probably benign Het
Clca4b A G 3: 144,915,576 I579T probably benign Het
Col20a1 T A 2: 180,984,485 probably benign Het
Creg2 T C 1: 39,624,976 I205V probably benign Het
Cyr61 C A 3: 145,647,748 C353F probably damaging Het
Ddx24 C T 12: 103,423,907 R275H probably damaging Het
Dip2c G A 13: 9,568,663 A579T probably benign Het
Dnah3 T C 7: 119,952,739 probably benign Het
Dnah8 G A 17: 30,673,920 probably null Het
Gckr T C 5: 31,326,915 probably benign Het
Gpbp1l1 A G 4: 116,581,239 probably benign Het
Hmcn2 A G 2: 31,391,511 T1913A probably benign Het
Lmo7 T C 14: 101,920,567 probably benign Het
Meioc G A 11: 102,680,031 V863I probably damaging Het
Myh1 A G 11: 67,205,925 I341V probably benign Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Myh13 A G 11: 67,345,002 T664A probably benign Het
Myo3b A C 2: 70,426,849 D1269A probably damaging Het
Nckap1 A G 2: 80,547,899 probably null Het
Nr3c2 A G 8: 76,908,668 probably null Het
Nxpe5 T C 5: 138,239,924 S249P probably damaging Het
Olfr1008 A G 2: 85,690,365 N312S probably benign Het
Olfr460 T C 6: 40,572,205 V273A probably benign Het
Olfr67 C T 7: 103,787,397 M293I probably benign Het
Pitpnm3 G A 11: 72,058,470 T675I probably damaging Het
Plekhm1 C A 11: 103,395,082 E176* probably null Het
Prdm11 C A 2: 92,989,222 probably benign Het
Prodh2 C A 7: 30,506,281 R218S probably damaging Het
Rps15a T C 7: 118,114,837 D54G probably benign Het
Sbno2 G T 10: 80,084,259 T46N possibly damaging Het
Sdk2 A G 11: 113,806,417 probably benign Het
Sema3c T C 5: 17,721,909 F567L probably damaging Het
Slc36a1 A G 11: 55,225,954 probably benign Het
Spaca6 A T 17: 17,838,391 E284V possibly damaging Het
Srsf3 C A 17: 29,036,438 L66I probably damaging Het
Srsf3 T A 17: 29,036,439 L66Q probably damaging Het
Syne1 T C 10: 5,043,652 T8363A possibly damaging Het
Trmt1 T A 8: 84,696,852 L298Q probably damaging Het
Uba6 T C 5: 86,119,401 I923V possibly damaging Het
Uhrf1bp1 A T 17: 27,887,178 T893S probably damaging Het
Vmn2r106 G A 17: 20,267,597 H847Y probably benign Het
Vmn2r15 T C 5: 109,297,535 T8A probably benign Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Zbtb41 T G 1: 139,439,031 F583V probably damaging Het
Zfp938 T A 10: 82,225,419 I456F probably benign Het
Other mutations in 4930433I11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02380:4930433I11Rik APN 7 40994544 missense possibly damaging 0.50
FR4304:4930433I11Rik UTSW 7 40993056 small deletion probably benign
FR4340:4930433I11Rik UTSW 7 40993055 small deletion probably benign
FR4342:4930433I11Rik UTSW 7 40993055 small deletion probably benign
FR4548:4930433I11Rik UTSW 7 40993056 small deletion probably benign
R0498:4930433I11Rik UTSW 7 40993294 missense probably benign 0.11
R0610:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0704:4930433I11Rik UTSW 7 40993957 missense probably damaging 1.00
R0723:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0826:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0850:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0862:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0863:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0960:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R0961:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R1099:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R1101:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R1167:4930433I11Rik UTSW 7 40993579 missense probably damaging 1.00
R1401:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R1429:4930433I11Rik UTSW 7 40993056 missense probably benign 0.22
R1462:4930433I11Rik UTSW 7 40992946 nonsense probably null
R1462:4930433I11Rik UTSW 7 40992946 nonsense probably null
R1816:4930433I11Rik UTSW 7 40994798 nonsense probably null
R1852:4930433I11Rik UTSW 7 40993613 missense probably benign 0.29
R3814:4930433I11Rik UTSW 7 40992919 missense probably damaging 0.99
R4124:4930433I11Rik UTSW 7 40993921 missense probably damaging 1.00
R4823:4930433I11Rik UTSW 7 40993362 missense probably benign 0.00
R5092:4930433I11Rik UTSW 7 40987667 start gained probably benign
R5792:4930433I11Rik UTSW 7 40993521 missense possibly damaging 0.76
R6160:4930433I11Rik UTSW 7 40993526 missense possibly damaging 0.91
R6300:4930433I11Rik UTSW 7 40993461 missense possibly damaging 0.91
R6349:4930433I11Rik UTSW 7 40994772 missense possibly damaging 0.89
R6755:4930433I11Rik UTSW 7 40994310 missense probably damaging 1.00
R6995:4930433I11Rik UTSW 7 40994725 missense probably benign 0.00
R7156:4930433I11Rik UTSW 7 40993858 missense possibly damaging 0.54
R7232:4930433I11Rik UTSW 7 40993179 missense probably damaging 1.00
R7318:4930433I11Rik UTSW 7 40993687 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCTTGACTCTTTTGCAGTGGTGGAAAT -3'
(R):5'- CTTTCTCTTCCAGACCCAGGTGGAT -3'

Sequencing Primer
(F):5'- AATGGATACATCCCTGGGATTGTC -3'
(R):5'- CCAAGCTGTCATTGTCAGAAG -3'
Posted On2013-11-07