Incidental Mutation 'R0964:Rps15a'
ID81479
Institutional Source Beutler Lab
Gene Symbol Rps15a
Ensembl Gene ENSMUSG00000008683
Gene Nameribosomal protein S15A
Synonyms
MMRRC Submission 039093-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R0964 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location118104372-118116188 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118114837 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 54 (D54G)
Ref Sequence ENSEMBL: ENSMUSP00000114544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032888] [ENSMUST00000106588] [ENSMUST00000106590] [ENSMUST00000128482] [ENSMUST00000131374] [ENSMUST00000131840] [ENSMUST00000172457]
Predicted Effect probably benign
Transcript: ENSMUST00000032888
SMART Domains Protein: ENSMUSP00000032888
Gene: ENSMUSG00000030654

DomainStartEndE-ValueType
transmembrane domain 42 61 N/A INTRINSIC
transmembrane domain 66 88 N/A INTRINSIC
transmembrane domain 136 153 N/A INTRINSIC
transmembrane domain 158 180 N/A INTRINSIC
low complexity region 192 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106588
AA Change: D54G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000102198
Gene: ENSMUSG00000008683
AA Change: D54G

DomainStartEndE-ValueType
Pfam:Ribosomal_S8 5 130 1.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106590
AA Change: D54G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000102200
Gene: ENSMUSG00000008683
AA Change: D54G

DomainStartEndE-ValueType
Pfam:Ribosomal_S8 5 108 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128482
AA Change: D54G

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000114544
Gene: ENSMUSG00000008683
AA Change: D54G

DomainStartEndE-ValueType
Pfam:Ribosomal_S8 5 68 9.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131374
AA Change: D54G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000119975
Gene: ENSMUSG00000008683
AA Change: D54G

DomainStartEndE-ValueType
Pfam:Ribosomal_S8 5 130 1.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131840
AA Change: D54G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000116061
Gene: ENSMUSG00000008683
AA Change: D54G

DomainStartEndE-ValueType
Pfam:Ribosomal_S8 5 67 1.1e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134270
Predicted Effect probably benign
Transcript: ENSMUST00000172457
AA Change: D54G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000127791
Gene: ENSMUSG00000008683
AA Change: D54G

DomainStartEndE-ValueType
Pfam:Ribosomal_S8 5 130 6.3e-36 PFAM
Meta Mutation Damage Score 0.328 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S8P family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Acacb A T 5: 114,229,752 M1604L possibly damaging Het
Acpp A G 9: 104,326,975 V40A possibly damaging Het
Adgrl1 T C 8: 83,934,412 probably benign Het
Alppl2 C T 1: 87,087,724 V372I possibly damaging Het
Apol8 C T 15: 77,749,611 S255N probably benign Het
Atp8b4 A T 2: 126,337,493 F973I probably damaging Het
Bbs4 A G 9: 59,322,976 *150Q probably null Het
Cacna1h A T 17: 25,378,775 probably benign Het
Ccser2 C T 14: 36,909,008 probably benign Het
Chd9 A G 8: 91,015,204 E1607G probably benign Het
Clca4b A G 3: 144,915,576 I579T probably benign Het
Col20a1 T A 2: 180,984,485 probably benign Het
Creg2 T C 1: 39,624,976 I205V probably benign Het
Cyr61 C A 3: 145,647,748 C353F probably damaging Het
Ddx24 C T 12: 103,423,907 R275H probably damaging Het
Dip2c G A 13: 9,568,663 A579T probably benign Het
Dnah3 T C 7: 119,952,739 probably benign Het
Dnah8 G A 17: 30,673,920 probably null Het
Gckr T C 5: 31,326,915 probably benign Het
Gpbp1l1 A G 4: 116,581,239 probably benign Het
Hmcn2 A G 2: 31,391,511 T1913A probably benign Het
Lmo7 T C 14: 101,920,567 probably benign Het
Meioc G A 11: 102,680,031 V863I probably damaging Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Myh1 A G 11: 67,205,925 I341V probably benign Het
Myh13 A G 11: 67,345,002 T664A probably benign Het
Myo3b A C 2: 70,426,849 D1269A probably damaging Het
Nckap1 A G 2: 80,547,899 probably null Het
Nr3c2 A G 8: 76,908,668 probably null Het
Nxpe5 T C 5: 138,239,924 S249P probably damaging Het
Olfr1008 A G 2: 85,690,365 N312S probably benign Het
Olfr460 T C 6: 40,572,205 V273A probably benign Het
Olfr67 C T 7: 103,787,397 M293I probably benign Het
Pitpnm3 G A 11: 72,058,470 T675I probably damaging Het
Plekhm1 C A 11: 103,395,082 E176* probably null Het
Prdm11 C A 2: 92,989,222 probably benign Het
Prodh2 C A 7: 30,506,281 R218S probably damaging Het
Sbno2 G T 10: 80,084,259 T46N possibly damaging Het
Sdk2 A G 11: 113,806,417 probably benign Het
Sema3c T C 5: 17,721,909 F567L probably damaging Het
Slc36a1 A G 11: 55,225,954 probably benign Het
Spaca6 A T 17: 17,838,391 E284V possibly damaging Het
Srsf3 C A 17: 29,036,438 L66I probably damaging Het
Srsf3 T A 17: 29,036,439 L66Q probably damaging Het
Syne1 T C 10: 5,043,652 T8363A possibly damaging Het
Trmt1 T A 8: 84,696,852 L298Q probably damaging Het
Uba6 T C 5: 86,119,401 I923V possibly damaging Het
Uhrf1bp1 A T 17: 27,887,178 T893S probably damaging Het
Vmn2r106 G A 17: 20,267,597 H847Y probably benign Het
Vmn2r15 T C 5: 109,297,535 T8A probably benign Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Zbtb41 T G 1: 139,439,031 F583V probably damaging Het
Zfp938 T A 10: 82,225,419 I456F probably benign Het
Other mutations in Rps15a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R7210:Rps15a UTSW 7 118109111 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AGCAGTTTCCCACTCCAGCGTTAC -3'
(R):5'- ATGTTCTGGCGGATGCTCTCAAG -3'

Sequencing Primer
(F):5'- ACTCCAGCGTTACCAGAGTTTAG -3'
(R):5'- CAGGCCATGTTCTAAAGTCATCG -3'
Posted On2013-11-07