Incidental Mutation 'R0971:Tmem120a'
ID81488
Institutional Source Beutler Lab
Gene Symbol Tmem120a
Ensembl Gene ENSMUSG00000039886
Gene Nametransmembrane protein 120A
SynonymsTmpit, 2010310D06Rik
MMRRC Submission 039100-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.885) question?
Stock #R0971 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location135735485-135744448 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135736104 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 272 (L272P)
Ref Sequence ENSEMBL: ENSMUSP00000045252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005651] [ENSMUST00000043378] [ENSMUST00000122113] [ENSMUST00000153399] [ENSMUST00000153500] [ENSMUST00000153515]
Predicted Effect probably benign
Transcript: ENSMUST00000005651
SMART Domains Protein: ENSMUSP00000005651
Gene: ENSMUSG00000005514

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Flavodoxin_1 82 219 1.6e-40 PFAM
Pfam:FAD_binding_1 274 493 1.3e-84 PFAM
Pfam:NAD_binding_1 530 642 2.8e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000043378
AA Change: L272P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045252
Gene: ENSMUSG00000039886
AA Change: L272P

DomainStartEndE-ValueType
Pfam:TMPIT 13 336 4.2e-159 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000122113
SMART Domains Protein: ENSMUSP00000112924
Gene: ENSMUSG00000005514

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Flavodoxin_1 82 219 2.6e-40 PFAM
Pfam:FAD_binding_1 274 493 5.1e-87 PFAM
Pfam:NAD_binding_1 530 605 3.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149684
Predicted Effect probably benign
Transcript: ENSMUST00000153399
SMART Domains Protein: ENSMUSP00000120834
Gene: ENSMUSG00000039886

DomainStartEndE-ValueType
Pfam:TMPIT 12 93 9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153500
SMART Domains Protein: ENSMUSP00000121531
Gene: ENSMUSG00000005514

DomainStartEndE-ValueType
transmembrane domain 22 44 N/A INTRINSIC
Pfam:Flavodoxin_1 82 219 5.9e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153515
SMART Domains Protein: ENSMUSP00000121022
Gene: ENSMUSG00000005514

DomainStartEndE-ValueType
transmembrane domain 22 44 N/A INTRINSIC
Pfam:Flavodoxin_1 82 219 3.2e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199952
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 G A 7: 81,092,579 E715K possibly damaging Het
Cbr2 T A 11: 120,730,433 I147F probably benign Het
Chdh A G 14: 30,033,663 N302S probably damaging Het
Cog5 T A 12: 31,919,678 H732Q probably benign Het
Glyr1 GCTGCC G 16: 5,021,345 probably null Het
Itln1 C A 1: 171,529,204 V236F probably damaging Het
Itpr1 A G 6: 108,349,629 E104G possibly damaging Het
Kcnh8 T A 17: 52,725,899 F71L probably benign Het
Kif14 T C 1: 136,519,654 M1399T probably damaging Het
Kif21a A G 15: 90,940,581 V1324A possibly damaging Het
Klhdc7b A T 15: 89,387,054 H713L possibly damaging Het
Opn5 C T 17: 42,611,327 probably null Het
Poteg A T 8: 27,447,939 Y41F probably damaging Het
Prpmp5 T A 6: 132,313,655 D27V unknown Het
Psd2 C A 18: 35,979,786 T178K probably damaging Het
Ptch1 T C 13: 63,539,843 T374A probably benign Het
Rgma T C 7: 73,391,498 probably null Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vmn1r40 A T 6: 89,714,290 I30F probably benign Het
Vps33b A G 7: 80,287,899 D465G possibly damaging Het
Zan G A 5: 137,434,063 A2324V unknown Het
Other mutations in Tmem120a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01434:Tmem120a APN 5 135737010 missense possibly damaging 0.87
IGL02548:Tmem120a APN 5 135736774 missense probably damaging 1.00
IGL02941:Tmem120a APN 5 135735751 missense probably damaging 1.00
R0194:Tmem120a UTSW 5 135742398 missense possibly damaging 0.79
R2117:Tmem120a UTSW 5 135736123 missense possibly damaging 0.88
R2392:Tmem120a UTSW 5 135742038 missense probably damaging 0.98
R3973:Tmem120a UTSW 5 135736277 missense probably benign 0.02
R4209:Tmem120a UTSW 5 135735705 missense probably benign
R5393:Tmem120a UTSW 5 135736250 unclassified probably null
R5629:Tmem120a UTSW 5 135742050 missense probably benign 0.06
R7430:Tmem120a UTSW 5 135736136 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CAGCGCATTGAAGAGTTGCCAG -3'
(R):5'- TCTCCATGTACCAGAGTGAGTTCCC -3'

Sequencing Primer
(F):5'- CATTGAAGAGTTGCCAGAACTG -3'
(R):5'- TGCAGTATTACTATCAGAGCGG -3'
Posted On2013-11-07