Incidental Mutation 'R0964:Bbs4'
List |< first << previous [record 82 of 958] next >> last >|
ID81489
Institutional Source Beutler Lab
Gene Symbol Bbs4
Ensembl Gene ENSMUSG00000025235
Gene NameBardet-Biedl syndrome 4 (human)
SynonymsD9Ertd464e
MMRRC Submission 039093-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.352) question?
Stock #R0964 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location59321990-59353508 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 59322976 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 150 (*150Q)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026265]
Predicted Effect probably benign
Transcript: ENSMUST00000026265
AA Change: V486A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000026265
Gene: ENSMUSG00000025235
AA Change: V486A

DomainStartEndE-ValueType
TPR 67 100 1.64e1 SMART
TPR 101 134 1.14e1 SMART
TPR 135 168 5.19e-3 SMART
TPR 169 201 3.67e-3 SMART
TPR 202 235 9.68e-3 SMART
TPR 270 303 1.26e-1 SMART
TPR 304 337 2.38e-2 SMART
TPR 338 371 1.64e1 SMART
low complexity region 490 504 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215994
Predicted Effect probably null
Transcript: ENSMUST00000217367
AA Change: *150Q
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Bardet-Biedl syndrome (BBS) gene family. Bardet-Biedl syndrome is an autosomal recessive disorder characterized by severe pigmentary retinopathy, obesity, polydactyly, renal malformation and mental retardation. The proteins encoded by BBS gene family members are structurally diverse. The similar phenotypes exhibited by mutations in BBS gene family members are likely due to the protein's shared roles in cilia formation and function. Many BBS proteins localize to the basal bodies, ciliary axonemes, and pericentriolar regions of cells. BBS proteins may also be involved in intracellular trafficking via microtubule-related transport. The protein encoded by this gene has sequence similarity to O-linked N-acetylglucosamine (O-GlcNAc) transferases in plants and archaebacteria and in human forms a multi-protein "BBSome" complex with seven other BBS proteins. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous null mice display partial embryonic lethality, low body weight before weaning, obesity and polyphagia after weaning, retinal degeneration, male infertility, absence of sperm cell flagella, renal abnormalities, impaired olfaction, and abnormal olfactory epithelium and neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Acacb A T 5: 114,229,752 M1604L possibly damaging Het
Acpp A G 9: 104,326,975 V40A possibly damaging Het
Adgrl1 T C 8: 83,934,412 probably benign Het
Alppl2 C T 1: 87,087,724 V372I possibly damaging Het
Apol8 C T 15: 77,749,611 S255N probably benign Het
Atp8b4 A T 2: 126,337,493 F973I probably damaging Het
Cacna1h A T 17: 25,378,775 probably benign Het
Ccser2 C T 14: 36,909,008 probably benign Het
Chd9 A G 8: 91,015,204 E1607G probably benign Het
Clca4b A G 3: 144,915,576 I579T probably benign Het
Col20a1 T A 2: 180,984,485 probably benign Het
Creg2 T C 1: 39,624,976 I205V probably benign Het
Cyr61 C A 3: 145,647,748 C353F probably damaging Het
Ddx24 C T 12: 103,423,907 R275H probably damaging Het
Dip2c G A 13: 9,568,663 A579T probably benign Het
Dnah3 T C 7: 119,952,739 probably benign Het
Dnah8 G A 17: 30,673,920 probably null Het
Gckr T C 5: 31,326,915 probably benign Het
Gpbp1l1 A G 4: 116,581,239 probably benign Het
Hmcn2 A G 2: 31,391,511 T1913A probably benign Het
Lmo7 T C 14: 101,920,567 probably benign Het
Meioc G A 11: 102,680,031 V863I probably damaging Het
Myh1 A G 11: 67,205,925 I341V probably benign Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Myh13 A G 11: 67,345,002 T664A probably benign Het
Myo3b A C 2: 70,426,849 D1269A probably damaging Het
Nckap1 A G 2: 80,547,899 probably null Het
Nr3c2 A G 8: 76,908,668 probably null Het
Nxpe5 T C 5: 138,239,924 S249P probably damaging Het
Olfr1008 A G 2: 85,690,365 N312S probably benign Het
Olfr460 T C 6: 40,572,205 V273A probably benign Het
Olfr67 C T 7: 103,787,397 M293I probably benign Het
Pitpnm3 G A 11: 72,058,470 T675I probably damaging Het
Plekhm1 C A 11: 103,395,082 E176* probably null Het
Prdm11 C A 2: 92,989,222 probably benign Het
Prodh2 C A 7: 30,506,281 R218S probably damaging Het
Rps15a T C 7: 118,114,837 D54G probably benign Het
Sbno2 G T 10: 80,084,259 T46N possibly damaging Het
Sdk2 A G 11: 113,806,417 probably benign Het
Sema3c T C 5: 17,721,909 F567L probably damaging Het
Slc36a1 A G 11: 55,225,954 probably benign Het
Spaca6 A T 17: 17,838,391 E284V possibly damaging Het
Srsf3 C A 17: 29,036,438 L66I probably damaging Het
Srsf3 T A 17: 29,036,439 L66Q probably damaging Het
Syne1 T C 10: 5,043,652 T8363A possibly damaging Het
Trmt1 T A 8: 84,696,852 L298Q probably damaging Het
Uba6 T C 5: 86,119,401 I923V possibly damaging Het
Uhrf1bp1 A T 17: 27,887,178 T893S probably damaging Het
Vmn2r106 G A 17: 20,267,597 H847Y probably benign Het
Vmn2r15 T C 5: 109,297,535 T8A probably benign Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Zbtb41 T G 1: 139,439,031 F583V probably damaging Het
Zfp938 T A 10: 82,225,419 I456F probably benign Het
Other mutations in Bbs4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Bbs4 APN 9 59324065 missense probably benign 0.00
IGL01360:Bbs4 APN 9 59339848 missense possibly damaging 0.89
IGL02005:Bbs4 APN 9 59336355 splice site probably benign
IGL02150:Bbs4 APN 9 59336368 missense probably benign
IGL02278:Bbs4 APN 9 59341168 missense possibly damaging 0.64
IGL02402:Bbs4 APN 9 59330446 missense probably benign 0.41
IGL02593:Bbs4 APN 9 59328597 missense probably damaging 0.99
IGL03328:Bbs4 APN 9 59344118 missense probably damaging 1.00
R1298:Bbs4 UTSW 9 59339813 missense probably damaging 1.00
R1944:Bbs4 UTSW 9 59330415 splice site probably null
R2986:Bbs4 UTSW 9 59341195 missense probably damaging 1.00
R4118:Bbs4 UTSW 9 59330425 missense possibly damaging 0.90
R4701:Bbs4 UTSW 9 59323519 missense probably benign
R6930:Bbs4 UTSW 9 59323481 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGGACGAAGTGTTAGCCTCCATC -3'
(R):5'- AGGGCACGCTATGAGGTAGACTTAG -3'

Sequencing Primer
(F):5'- AGCCTCCATCTGCCTGG -3'
(R):5'- CGCTATGAGGTAGACTTAGACAGG -3'
Posted On2013-11-07