Incidental Mutation 'R0964:Acpp'
ID81490
Institutional Source Beutler Lab
Gene Symbol Acpp
Ensembl Gene ENSMUSG00000032561
Gene Nameacid phosphatase, prostate
SynonymsA030005E02Rik, PAP
MMRRC Submission 039093-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R0964 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location104288251-104337748 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104326975 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 40 (V40A)
Ref Sequence ENSEMBL: ENSMUSP00000108209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062723] [ENSMUST00000112590] [ENSMUST00000215852]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062723
AA Change: V40A

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000059889
Gene: ENSMUSG00000032561
AA Change: V40A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:His_Phos_2 33 331 3.8e-35 PFAM
transmembrane domain 382 404 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112590
AA Change: V40A

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108209
Gene: ENSMUSG00000032561
AA Change: V40A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
Pfam:His_Phos_2 33 331 1.8e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128635
Predicted Effect possibly damaging
Transcript: ENSMUST00000215852
AA Change: V40A

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
Meta Mutation Damage Score 0.182 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the conversion of orthophosphoric monoester to alcohol and orthophosphate. It is synthesized under androgen regulation and is secreted by the epithelial cells of the prostate gland. An alternatively spliced transcript variant encoding a longer isoform has been found for this gene. This isoform contains a transmembrane domain and is localized in the plasma membrane-endosomal-lysosomal pathway. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased thermal nociceptive threshold and mechanical allodynia in chronic inflammatory and nerve injury pain models. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Acacb A T 5: 114,229,752 M1604L possibly damaging Het
Adgrl1 T C 8: 83,934,412 probably benign Het
Alppl2 C T 1: 87,087,724 V372I possibly damaging Het
Apol8 C T 15: 77,749,611 S255N probably benign Het
Atp8b4 A T 2: 126,337,493 F973I probably damaging Het
Bbs4 A G 9: 59,322,976 *150Q probably null Het
Cacna1h A T 17: 25,378,775 probably benign Het
Ccser2 C T 14: 36,909,008 probably benign Het
Chd9 A G 8: 91,015,204 E1607G probably benign Het
Clca4b A G 3: 144,915,576 I579T probably benign Het
Col20a1 T A 2: 180,984,485 probably benign Het
Creg2 T C 1: 39,624,976 I205V probably benign Het
Cyr61 C A 3: 145,647,748 C353F probably damaging Het
Ddx24 C T 12: 103,423,907 R275H probably damaging Het
Dip2c G A 13: 9,568,663 A579T probably benign Het
Dnah3 T C 7: 119,952,739 probably benign Het
Dnah8 G A 17: 30,673,920 probably null Het
Gckr T C 5: 31,326,915 probably benign Het
Gpbp1l1 A G 4: 116,581,239 probably benign Het
Hmcn2 A G 2: 31,391,511 T1913A probably benign Het
Lmo7 T C 14: 101,920,567 probably benign Het
Meioc G A 11: 102,680,031 V863I probably damaging Het
Myh1 A G 11: 67,205,925 I341V probably benign Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Myh13 A G 11: 67,345,002 T664A probably benign Het
Myo3b A C 2: 70,426,849 D1269A probably damaging Het
Nckap1 A G 2: 80,547,899 probably null Het
Nr3c2 A G 8: 76,908,668 probably null Het
Nxpe5 T C 5: 138,239,924 S249P probably damaging Het
Olfr1008 A G 2: 85,690,365 N312S probably benign Het
Olfr460 T C 6: 40,572,205 V273A probably benign Het
Olfr67 C T 7: 103,787,397 M293I probably benign Het
Pitpnm3 G A 11: 72,058,470 T675I probably damaging Het
Plekhm1 C A 11: 103,395,082 E176* probably null Het
Prdm11 C A 2: 92,989,222 probably benign Het
Prodh2 C A 7: 30,506,281 R218S probably damaging Het
Rps15a T C 7: 118,114,837 D54G probably benign Het
Sbno2 G T 10: 80,084,259 T46N possibly damaging Het
Sdk2 A G 11: 113,806,417 probably benign Het
Sema3c T C 5: 17,721,909 F567L probably damaging Het
Slc36a1 A G 11: 55,225,954 probably benign Het
Spaca6 A T 17: 17,838,391 E284V possibly damaging Het
Srsf3 C A 17: 29,036,438 L66I probably damaging Het
Srsf3 T A 17: 29,036,439 L66Q probably damaging Het
Syne1 T C 10: 5,043,652 T8363A possibly damaging Het
Trmt1 T A 8: 84,696,852 L298Q probably damaging Het
Uba6 T C 5: 86,119,401 I923V possibly damaging Het
Uhrf1bp1 A T 17: 27,887,178 T893S probably damaging Het
Vmn2r106 G A 17: 20,267,597 H847Y probably benign Het
Vmn2r15 T C 5: 109,297,535 T8A probably benign Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Zbtb41 T G 1: 139,439,031 F583V probably damaging Het
Zfp938 T A 10: 82,225,419 I456F probably benign Het
Other mutations in Acpp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02580:Acpp APN 9 104326948 missense probably damaging 1.00
IGL02994:Acpp APN 9 104309403 splice site probably benign
IGL03069:Acpp APN 9 104320005 missense possibly damaging 0.78
R0076:Acpp UTSW 9 104324218 splice site probably benign
R0076:Acpp UTSW 9 104324218 splice site probably benign
R0084:Acpp UTSW 9 104314365 missense probably benign 0.07
R0098:Acpp UTSW 9 104319945 unclassified probably null
R0119:Acpp UTSW 9 104320002 missense probably damaging 1.00
R0299:Acpp UTSW 9 104320002 missense probably damaging 1.00
R0362:Acpp UTSW 9 104314427 missense probably damaging 1.00
R0499:Acpp UTSW 9 104320002 missense probably damaging 1.00
R0514:Acpp UTSW 9 104319978 missense probably damaging 1.00
R1506:Acpp UTSW 9 104324174 missense probably damaging 1.00
R1624:Acpp UTSW 9 104320001 missense probably benign 0.39
R2019:Acpp UTSW 9 104324702 missense probably damaging 1.00
R3821:Acpp UTSW 9 104324717 missense probably damaging 0.99
R3822:Acpp UTSW 9 104324717 missense probably damaging 0.99
R4896:Acpp UTSW 9 104306975 missense probably damaging 1.00
R5084:Acpp UTSW 9 104326917 missense probably damaging 1.00
R5257:Acpp UTSW 9 104309475 missense probably benign 0.24
R5258:Acpp UTSW 9 104309475 missense probably benign 0.24
R5519:Acpp UTSW 9 104291488 missense probably damaging 1.00
R5795:Acpp UTSW 9 104309489 missense probably benign 0.04
R6909:Acpp UTSW 9 104300965 missense probably damaging 1.00
R7315:Acpp UTSW 9 104316224 critical splice donor site probably null
R7349:Acpp UTSW 9 104291458 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTCACACTGAAAATATAGTCAGCGGG -3'
(R):5'- GCTCATGCGCCAGTCTATTGTCTTAG -3'

Sequencing Primer
(F):5'- tgggaggtggagggagg -3'
(R):5'- cataaacccaactaacaaaaccaag -3'
Posted On2013-11-07