Incidental Mutation 'R0971:Vmn1r40'
ID81492
Institutional Source Beutler Lab
Gene Symbol Vmn1r40
Ensembl Gene ENSMUSG00000096051
Gene Namevomeronasal 1 receptor 40
SynonymsV1rb7
MMRRC Submission 039100-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R0971 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location89707540-89716657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89714290 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 30 (I30F)
Ref Sequence ENSEMBL: ENSMUSP00000154581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075158] [ENSMUST00000226925] [ENSMUST00000227669] [ENSMUST00000228485] [ENSMUST00000228642]
Predicted Effect probably benign
Transcript: ENSMUST00000075158
AA Change: I30F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000074655
Gene: ENSMUSG00000096051
AA Change: I30F

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Pfam:V1R 38 302 3.4e-143 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226925
AA Change: I30F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000227669
Predicted Effect probably benign
Transcript: ENSMUST00000228485
Predicted Effect probably benign
Transcript: ENSMUST00000228642
AA Change: I30F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 G A 7: 81,092,579 E715K possibly damaging Het
Cbr2 T A 11: 120,730,433 I147F probably benign Het
Chdh A G 14: 30,033,663 N302S probably damaging Het
Cog5 T A 12: 31,919,678 H732Q probably benign Het
Glyr1 GCTGCC G 16: 5,021,345 probably null Het
Itln1 C A 1: 171,529,204 V236F probably damaging Het
Itpr1 A G 6: 108,349,629 E104G possibly damaging Het
Kcnh8 T A 17: 52,725,899 F71L probably benign Het
Kif14 T C 1: 136,519,654 M1399T probably damaging Het
Kif21a A G 15: 90,940,581 V1324A possibly damaging Het
Klhdc7b A T 15: 89,387,054 H713L possibly damaging Het
Opn5 C T 17: 42,611,327 probably null Het
Poteg A T 8: 27,447,939 Y41F probably damaging Het
Prpmp5 T A 6: 132,313,655 D27V unknown Het
Psd2 C A 18: 35,979,786 T178K probably damaging Het
Ptch1 T C 13: 63,539,843 T374A probably benign Het
Rgma T C 7: 73,391,498 probably null Het
Tmem120a A G 5: 135,736,104 L272P probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vps33b A G 7: 80,287,899 D465G possibly damaging Het
Zan G A 5: 137,434,063 A2324V unknown Het
Other mutations in Vmn1r40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Vmn1r40 APN 6 89714596 missense probably damaging 0.99
IGL01432:Vmn1r40 APN 6 89714219 missense probably benign
IGL01777:Vmn1r40 APN 6 89714222 missense probably benign 0.38
IGL01834:Vmn1r40 APN 6 89714572 missense possibly damaging 0.62
IGL01908:Vmn1r40 APN 6 89714309 missense probably damaging 0.97
IGL01908:Vmn1r40 APN 6 89714303 missense probably benign 0.00
IGL01999:Vmn1r40 APN 6 89714966 missense probably benign 0.00
IGL02728:Vmn1r40 APN 6 89715016 missense probably benign 0.05
IGL03169:Vmn1r40 APN 6 89715023 missense probably damaging 0.97
R0448:Vmn1r40 UTSW 6 89714660 missense probably benign 0.23
R1208:Vmn1r40 UTSW 6 89714344 missense probably benign 0.13
R1208:Vmn1r40 UTSW 6 89714344 missense probably benign 0.13
R1448:Vmn1r40 UTSW 6 89714576 missense probably damaging 1.00
R1739:Vmn1r40 UTSW 6 89714315 missense probably benign 0.00
R2170:Vmn1r40 UTSW 6 89714975 missense probably benign 0.11
R3151:Vmn1r40 UTSW 6 89714566 missense probably benign 0.01
R3804:Vmn1r40 UTSW 6 89715009 missense probably benign 0.29
R5098:Vmn1r40 UTSW 6 89714948 missense probably damaging 1.00
R6015:Vmn1r40 UTSW 6 89714606 missense probably damaging 1.00
R7216:Vmn1r40 UTSW 6 89714624 missense not run
Predicted Primers PCR Primer
(F):5'- GTTGGCATTTGTGAACAAGGCCATC -3'
(R):5'- TGCAGAAAACATGCTTGTCCTGGAG -3'

Sequencing Primer
(F):5'- GCCAATATGCTCCGAACTGA -3'
(R):5'- CTTGTCCTGGAGTAACTCAGAG -3'
Posted On2013-11-07