Incidental Mutation 'R0964:Sbno2'
ID81495
Institutional Source Beutler Lab
Gene Symbol Sbno2
Ensembl Gene ENSMUSG00000035673
Gene Namestrawberry notch 2
SynonymsStno
MMRRC Submission 039093-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.329) question?
Stock #R0964 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location80056992-80105571 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 80084259 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 46 (T46N)
Ref Sequence ENSEMBL: ENSMUSP00000151835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042771] [ENSMUST00000218630] [ENSMUST00000219258] [ENSMUST00000219260]
Predicted Effect probably benign
Transcript: ENSMUST00000042771
AA Change: T46N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000041635
Gene: ENSMUSG00000035673
AA Change: T46N

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
low complexity region 177 189 N/A INTRINSIC
Pfam:AAA_34 209 500 8.2e-135 PFAM
Pfam:ResIII 239 419 7.7e-8 PFAM
low complexity region 611 631 N/A INTRINSIC
Pfam:Helicase_C_4 726 1004 7.5e-120 PFAM
low complexity region 1263 1283 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218462
Predicted Effect probably benign
Transcript: ENSMUST00000218630
AA Change: T46N

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect possibly damaging
Transcript: ENSMUST00000219258
AA Change: T46N

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect probably benign
Transcript: ENSMUST00000219260
AA Change: T46N

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency 98% (55/56)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired osteoclast fusion, impaired osteoblastogenesis, osteopetrosis, increased bone mass, and decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
Acacb A T 5: 114,229,752 M1604L possibly damaging Het
Acpp A G 9: 104,326,975 V40A possibly damaging Het
Adgrl1 T C 8: 83,934,412 probably benign Het
Alppl2 C T 1: 87,087,724 V372I possibly damaging Het
Apol8 C T 15: 77,749,611 S255N probably benign Het
Atp8b4 A T 2: 126,337,493 F973I probably damaging Het
Bbs4 A G 9: 59,322,976 *150Q probably null Het
Cacna1h A T 17: 25,378,775 probably benign Het
Ccser2 C T 14: 36,909,008 probably benign Het
Chd9 A G 8: 91,015,204 E1607G probably benign Het
Clca4b A G 3: 144,915,576 I579T probably benign Het
Col20a1 T A 2: 180,984,485 probably benign Het
Creg2 T C 1: 39,624,976 I205V probably benign Het
Cyr61 C A 3: 145,647,748 C353F probably damaging Het
Ddx24 C T 12: 103,423,907 R275H probably damaging Het
Dip2c G A 13: 9,568,663 A579T probably benign Het
Dnah3 T C 7: 119,952,739 probably benign Het
Dnah8 G A 17: 30,673,920 probably null Het
Gckr T C 5: 31,326,915 probably benign Het
Gpbp1l1 A G 4: 116,581,239 probably benign Het
Hmcn2 A G 2: 31,391,511 T1913A probably benign Het
Lmo7 T C 14: 101,920,567 probably benign Het
Meioc G A 11: 102,680,031 V863I probably damaging Het
Myh1 A G 11: 67,205,925 I341V probably benign Het
Myh1 A G 11: 67,221,604 D1799G probably damaging Het
Myh13 A G 11: 67,345,002 T664A probably benign Het
Myo3b A C 2: 70,426,849 D1269A probably damaging Het
Nckap1 A G 2: 80,547,899 probably null Het
Nr3c2 A G 8: 76,908,668 probably null Het
Nxpe5 T C 5: 138,239,924 S249P probably damaging Het
Olfr1008 A G 2: 85,690,365 N312S probably benign Het
Olfr460 T C 6: 40,572,205 V273A probably benign Het
Olfr67 C T 7: 103,787,397 M293I probably benign Het
Pitpnm3 G A 11: 72,058,470 T675I probably damaging Het
Plekhm1 C A 11: 103,395,082 E176* probably null Het
Prdm11 C A 2: 92,989,222 probably benign Het
Prodh2 C A 7: 30,506,281 R218S probably damaging Het
Rps15a T C 7: 118,114,837 D54G probably benign Het
Sdk2 A G 11: 113,806,417 probably benign Het
Sema3c T C 5: 17,721,909 F567L probably damaging Het
Slc36a1 A G 11: 55,225,954 probably benign Het
Spaca6 A T 17: 17,838,391 E284V possibly damaging Het
Srsf3 C A 17: 29,036,438 L66I probably damaging Het
Srsf3 T A 17: 29,036,439 L66Q probably damaging Het
Syne1 T C 10: 5,043,652 T8363A possibly damaging Het
Trmt1 T A 8: 84,696,852 L298Q probably damaging Het
Uba6 T C 5: 86,119,401 I923V possibly damaging Het
Uhrf1bp1 A T 17: 27,887,178 T893S probably damaging Het
Vmn2r106 G A 17: 20,267,597 H847Y probably benign Het
Vmn2r15 T C 5: 109,297,535 T8A probably benign Het
Zbtb39 C G 10: 127,742,306 Q250E probably benign Het
Zbtb41 T G 1: 139,439,031 F583V probably damaging Het
Zfp938 T A 10: 82,225,419 I456F probably benign Het
Other mutations in Sbno2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Sbno2 APN 10 80064506 splice site probably benign
IGL01773:Sbno2 APN 10 80057831 missense probably damaging 1.00
IGL01869:Sbno2 APN 10 80060392 critical splice donor site probably null
IGL01911:Sbno2 APN 10 80069624 nonsense probably null
IGL02071:Sbno2 APN 10 80060641 missense probably damaging 1.00
IGL02094:Sbno2 APN 10 80057645 missense probably benign
IGL02220:Sbno2 APN 10 80072368 missense probably benign 0.04
IGL02366:Sbno2 APN 10 80064202 missense probably damaging 1.00
IGL02608:Sbno2 APN 10 80067402 splice site probably null
IGL03007:Sbno2 APN 10 80058550 splice site probably benign
IGL03083:Sbno2 APN 10 80057534 missense probably damaging 0.98
IGL03393:Sbno2 APN 10 80066901 missense probably damaging 1.00
R0034:Sbno2 UTSW 10 80058340 splice site probably benign
R0126:Sbno2 UTSW 10 80068853 splice site probably null
R0652:Sbno2 UTSW 10 80067294 missense probably damaging 1.00
R1571:Sbno2 UTSW 10 80060392 critical splice donor site probably null
R1601:Sbno2 UTSW 10 80060492 missense probably damaging 0.98
R1634:Sbno2 UTSW 10 80060634 missense possibly damaging 0.73
R1733:Sbno2 UTSW 10 80058508 missense possibly damaging 0.92
R1762:Sbno2 UTSW 10 80066606 missense probably damaging 1.00
R1832:Sbno2 UTSW 10 80060605 nonsense probably null
R1859:Sbno2 UTSW 10 80058639 nonsense probably null
R2086:Sbno2 UTSW 10 80057856 missense possibly damaging 0.89
R2136:Sbno2 UTSW 10 80062693 missense probably damaging 1.00
R2360:Sbno2 UTSW 10 80058021 missense possibly damaging 0.81
R4426:Sbno2 UTSW 10 80072358 missense probably null 0.02
R4504:Sbno2 UTSW 10 80060492 missense possibly damaging 0.46
R4692:Sbno2 UTSW 10 80086327 missense possibly damaging 0.90
R5044:Sbno2 UTSW 10 80062188 missense probably benign 0.11
R5166:Sbno2 UTSW 10 80066928 nonsense probably null
R5576:Sbno2 UTSW 10 80067337 missense probably damaging 0.99
R5665:Sbno2 UTSW 10 80058453 missense probably benign 0.00
R5709:Sbno2 UTSW 10 80086337 start codon destroyed probably null 0.89
R5828:Sbno2 UTSW 10 80066590 missense possibly damaging 0.84
R6192:Sbno2 UTSW 10 80060016 missense probably damaging 0.99
R6971:Sbno2 UTSW 10 80060034 missense possibly damaging 0.95
R7012:Sbno2 UTSW 10 80069518 intron probably benign
R7082:Sbno2 UTSW 10 80060090 splice site probably null
R7133:Sbno2 UTSW 10 80086312 missense probably damaging 1.00
R7438:Sbno2 UTSW 10 80069575 missense unknown
R7481:Sbno2 UTSW 10 80057499 missense probably benign 0.11
X0026:Sbno2 UTSW 10 80057459 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- TCTCCCCAGGCAAACTCCTTCTAAG -3'
(R):5'- GAACCTCAGCTTTTCCAGGGTACAC -3'

Sequencing Primer
(F):5'- CTTCTAAGCCTTTAAAAGCCAGG -3'
(R):5'- cccacccccatcctctc -3'
Posted On2013-11-07