Incidental Mutation 'R0971:Vps33b'
ID81502
Institutional Source Beutler Lab
Gene Symbol Vps33b
Ensembl Gene ENSMUSG00000030534
Gene Namevacuolar protein sorting 33B
Synonyms
MMRRC Submission 039100-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0971 (G1)
Quality Score182
Status Not validated
Chromosome7
Chromosomal Location80269649-80291754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80287899 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 465 (D465G)
Ref Sequence ENSEMBL: ENSMUSP00000032749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032749] [ENSMUST00000135053] [ENSMUST00000150585]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032749
AA Change: D465G

PolyPhen 2 Score 0.750 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000032749
Gene: ENSMUSG00000030534
AA Change: D465G

DomainStartEndE-ValueType
Pfam:Sec1 37 611 2.4e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128254
Predicted Effect probably benign
Transcript: ENSMUST00000135053
SMART Domains Protein: ENSMUSP00000138472
Gene: ENSMUSG00000030534

DomainStartEndE-ValueType
SCOP:d1epua_ 18 59 2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135470
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145594
Predicted Effect probably benign
Transcript: ENSMUST00000150585
SMART Domains Protein: ENSMUSP00000138224
Gene: ENSMUSG00000030534

DomainStartEndE-ValueType
Pfam:Sec1 36 140 1.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205864
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene is a member of the Sec-1 domain family, and encodes the human ortholog of rat Vps33b which is homologous to the yeast class C Vps33 protein. The mammalian class C vacuolar protein sorting proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Mutations in this gene are associated with arthrogryposis-renal dysfunction-cholestasis syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a conditional allele activated by an inducible cre exhibit dry scaly skin, hair loss, thrombocytosis, abnormal alpha-granule development, extramedullary hematopoiesis, abnormal platelets and megakaryocytes, and defects in tail tendon collagen I structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 G A 7: 81,092,579 E715K possibly damaging Het
Cbr2 T A 11: 120,730,433 I147F probably benign Het
Chdh A G 14: 30,033,663 N302S probably damaging Het
Cog5 T A 12: 31,919,678 H732Q probably benign Het
Glyr1 GCTGCC G 16: 5,021,345 probably null Het
Itln1 C A 1: 171,529,204 V236F probably damaging Het
Itpr1 A G 6: 108,349,629 E104G possibly damaging Het
Kcnh8 T A 17: 52,725,899 F71L probably benign Het
Kif14 T C 1: 136,519,654 M1399T probably damaging Het
Kif21a A G 15: 90,940,581 V1324A possibly damaging Het
Klhdc7b A T 15: 89,387,054 H713L possibly damaging Het
Opn5 C T 17: 42,611,327 probably null Het
Poteg A T 8: 27,447,939 Y41F probably damaging Het
Prpmp5 T A 6: 132,313,655 D27V unknown Het
Psd2 C A 18: 35,979,786 T178K probably damaging Het
Ptch1 T C 13: 63,539,843 T374A probably benign Het
Rgma T C 7: 73,391,498 probably null Het
Tmem120a A G 5: 135,736,104 L272P probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vmn1r40 A T 6: 89,714,290 I30F probably benign Het
Zan G A 5: 137,434,063 A2324V unknown Het
Other mutations in Vps33b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Vps33b APN 7 80285843 missense probably damaging 1.00
IGL01352:Vps33b APN 7 80285059 unclassified probably null
IGL01863:Vps33b APN 7 80274311 critical splice donor site probably null
IGL01918:Vps33b APN 7 80287812 unclassified probably null
IGL02152:Vps33b APN 7 80285069 missense probably benign 0.29
IGL02364:Vps33b APN 7 80287839 missense probably damaging 1.00
IGL02383:Vps33b APN 7 80285334 unclassified probably null
IGL02669:Vps33b APN 7 80276038 splice site probably benign
IGL03104:Vps33b APN 7 80276083 missense probably damaging 1.00
IGL03333:Vps33b APN 7 80274225 splice site probably benign
PIT4651001:Vps33b UTSW 7 80290007 missense probably damaging 0.99
R0267:Vps33b UTSW 7 80286054 missense possibly damaging 0.87
R0379:Vps33b UTSW 7 80283414 splice site probably null
R1184:Vps33b UTSW 7 80282486 missense probably benign 0.02
R1639:Vps33b UTSW 7 80284353 missense probably damaging 1.00
R1693:Vps33b UTSW 7 80287893 missense probably damaging 1.00
R4502:Vps33b UTSW 7 80287907 missense possibly damaging 0.94
R4609:Vps33b UTSW 7 80291118 missense probably benign 0.00
R4748:Vps33b UTSW 7 80290048 missense probably damaging 1.00
R5083:Vps33b UTSW 7 80274641 missense probably damaging 0.99
R5304:Vps33b UTSW 7 80274253 missense probably damaging 1.00
R5774:Vps33b UTSW 7 80285340 missense probably benign 0.38
R5991:Vps33b UTSW 7 80283414 splice site probably null
R7085:Vps33b UTSW 7 80276089 missense probably benign 0.12
R7409:Vps33b UTSW 7 80285269 missense probably damaging 0.97
X0018:Vps33b UTSW 7 80290565 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTTGATACTGCCACTCACGAGAGC -3'
(R):5'- TCAATGCAGTGCAGGCATCAGC -3'

Sequencing Primer
(F):5'- CAGAGTGCGTGTGACTTCC -3'
(R):5'- aaggaaagcaagggaaacaac -3'
Posted On2013-11-07