Incidental Mutation 'R0971:Chdh'
ID81513
Institutional Source Beutler Lab
Gene Symbol Chdh
Ensembl Gene ENSMUSG00000015970
Gene Namecholine dehydrogenase
SynonymsD630034H06Rik
MMRRC Submission 039100-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0971 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location30009023-30040527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30033663 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 302 (N302S)
Ref Sequence ENSEMBL: ENSMUSP00000112916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067620] [ENSMUST00000118917]
Predicted Effect probably damaging
Transcript: ENSMUST00000067620
AA Change: N302S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065542
Gene: ENSMUSG00000015970
AA Change: N302S

DomainStartEndE-ValueType
Pfam:GMC_oxred_N 43 341 2.4e-98 PFAM
Pfam:Lycopene_cycl 45 110 8.4e-8 PFAM
Pfam:GMC_oxred_C 431 569 2.5e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118917
AA Change: N302S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112916
Gene: ENSMUSG00000015970
AA Change: N302S

DomainStartEndE-ValueType
Pfam:GMC_oxred_N 43 341 2.4e-98 PFAM
Pfam:Lycopene_cycl 44 109 1.9e-8 PFAM
Pfam:GMC_oxred_C 431 569 5.9e-42 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a choline dehydrogenase that localizes to the mitochondrion. Variations in this gene can affect susceptibility to choline deficiency. A few transcript variants have been found for this gene, but the full-length nature of only one has been characterized to date. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous male mutants show reduced fertility due to reduced sperm motility caused by abnormal mitochondrial function and structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 G A 7: 81,092,579 E715K possibly damaging Het
Cbr2 T A 11: 120,730,433 I147F probably benign Het
Cog5 T A 12: 31,919,678 H732Q probably benign Het
Glyr1 GCTGCC G 16: 5,021,345 probably null Het
Itln1 C A 1: 171,529,204 V236F probably damaging Het
Itpr1 A G 6: 108,349,629 E104G possibly damaging Het
Kcnh8 T A 17: 52,725,899 F71L probably benign Het
Kif14 T C 1: 136,519,654 M1399T probably damaging Het
Kif21a A G 15: 90,940,581 V1324A possibly damaging Het
Klhdc7b A T 15: 89,387,054 H713L possibly damaging Het
Opn5 C T 17: 42,611,327 probably null Het
Poteg A T 8: 27,447,939 Y41F probably damaging Het
Prpmp5 T A 6: 132,313,655 D27V unknown Het
Psd2 C A 18: 35,979,786 T178K probably damaging Het
Ptch1 T C 13: 63,539,843 T374A probably benign Het
Rgma T C 7: 73,391,498 probably null Het
Tmem120a A G 5: 135,736,104 L272P probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vmn1r40 A T 6: 89,714,290 I30F probably benign Het
Vps33b A G 7: 80,287,899 D465G possibly damaging Het
Zan G A 5: 137,434,063 A2324V unknown Het
Other mutations in Chdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Chdh APN 14 30031332 missense probably benign 0.15
IGL01309:Chdh APN 14 30035804 unclassified probably benign
IGL01515:Chdh APN 14 30036886 missense probably damaging 1.00
IGL01828:Chdh APN 14 30036608 missense probably damaging 0.96
IGL01953:Chdh APN 14 30035347 missense probably benign 0.24
IGL01989:Chdh APN 14 30031731 missense possibly damaging 0.71
IGL02325:Chdh APN 14 30032825 missense probably benign 0.01
IGL02620:Chdh APN 14 30031139 missense probably damaging 0.99
IGL03180:Chdh APN 14 30034602 splice site probably null
R0024:Chdh UTSW 14 30031596 missense possibly damaging 0.81
R0455:Chdh UTSW 14 30034646 missense probably damaging 1.00
R0486:Chdh UTSW 14 30032858 missense possibly damaging 0.83
R0668:Chdh UTSW 14 30035880 missense probably damaging 1.00
R0684:Chdh UTSW 14 30031613 missense probably damaging 1.00
R1291:Chdh UTSW 14 30031562 nonsense probably null
R1381:Chdh UTSW 14 30036834 missense probably damaging 1.00
R1386:Chdh UTSW 14 30031434 missense probably damaging 1.00
R1412:Chdh UTSW 14 30034723 missense probably benign 0.01
R1912:Chdh UTSW 14 30032788 missense probably benign 0.00
R2198:Chdh UTSW 14 30031532 missense possibly damaging 0.91
R4077:Chdh UTSW 14 30035340 missense probably damaging 0.99
R4412:Chdh UTSW 14 30031715 missense probably damaging 1.00
R4713:Chdh UTSW 14 30036841 missense probably benign 0.28
R4865:Chdh UTSW 14 30033724 missense probably benign 0.00
R4940:Chdh UTSW 14 30032852 missense possibly damaging 0.82
R5207:Chdh UTSW 14 30031361 missense probably damaging 1.00
R5582:Chdh UTSW 14 30036859 missense probably damaging 1.00
R5710:Chdh UTSW 14 30034627 missense probably damaging 1.00
R5954:Chdh UTSW 14 30031181 missense possibly damaging 0.87
R6245:Chdh UTSW 14 30035305 missense probably damaging 0.99
R7032:Chdh UTSW 14 30036852 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGTGGTGTAATTTCCAAAGGCCCAG -3'
(R):5'- AGGATGCTCTCCTAAAGGGTGCAG -3'

Sequencing Primer
(F):5'- CCAGCAATGGCTGGAACTG -3'
(R):5'- CCAGATGCCCTCAGATGTATAGG -3'
Posted On2013-11-07