Incidental Mutation 'R0971:Klhdc7b'
ID81514
Institutional Source Beutler Lab
Gene Symbol Klhdc7b
Ensembl Gene ENSMUSG00000091680
Gene Namekelch domain containing 7B
SynonymsEG546648
MMRRC Submission 039100-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.264) question?
Stock #R0971 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location89384917-89388867 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89387054 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 713 (H713L)
Ref Sequence ENSEMBL: ENSMUSP00000153286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109314] [ENSMUST00000166926] [ENSMUST00000167959] [ENSMUST00000225666]
Predicted Effect probably benign
Transcript: ENSMUST00000109314
SMART Domains Protein: ENSMUSP00000104937
Gene: ENSMUSG00000078938

DomainStartEndE-ValueType
Pfam:Synaptonemal_3 1 86 4e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166926
AA Change: H55L

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000130884
Gene: ENSMUSG00000091680
AA Change: H55L

DomainStartEndE-ValueType
low complexity region 130 146 N/A INTRINSIC
Kelch 366 416 1.04e-6 SMART
Kelch 417 461 4.9e-3 SMART
Kelch 462 504 4.18e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167959
SMART Domains Protein: ENSMUSP00000131766
Gene: ENSMUSG00000078938

DomainStartEndE-ValueType
Pfam:Synaptonemal_3 1 85 6.6e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000225666
AA Change: H713L

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 G A 7: 81,092,579 E715K possibly damaging Het
Cbr2 T A 11: 120,730,433 I147F probably benign Het
Chdh A G 14: 30,033,663 N302S probably damaging Het
Cog5 T A 12: 31,919,678 H732Q probably benign Het
Glyr1 GCTGCC G 16: 5,021,345 probably null Het
Itln1 C A 1: 171,529,204 V236F probably damaging Het
Itpr1 A G 6: 108,349,629 E104G possibly damaging Het
Kcnh8 T A 17: 52,725,899 F71L probably benign Het
Kif14 T C 1: 136,519,654 M1399T probably damaging Het
Kif21a A G 15: 90,940,581 V1324A possibly damaging Het
Opn5 C T 17: 42,611,327 probably null Het
Poteg A T 8: 27,447,939 Y41F probably damaging Het
Prpmp5 T A 6: 132,313,655 D27V unknown Het
Psd2 C A 18: 35,979,786 T178K probably damaging Het
Ptch1 T C 13: 63,539,843 T374A probably benign Het
Rgma T C 7: 73,391,498 probably null Het
Tmem120a A G 5: 135,736,104 L272P probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vmn1r40 A T 6: 89,714,290 I30F probably benign Het
Vps33b A G 7: 80,287,899 D465G possibly damaging Het
Zan G A 5: 137,434,063 A2324V unknown Het
Other mutations in Klhdc7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01574:Klhdc7b APN 15 89387369 missense probably benign 0.02
IGL02711:Klhdc7b APN 15 89388043 nonsense probably null
R0115:Klhdc7b UTSW 15 89388521 missense probably benign 0.05
R0718:Klhdc7b UTSW 15 89388169 missense possibly damaging 0.91
R0729:Klhdc7b UTSW 15 89387395 nonsense probably null
R1794:Klhdc7b UTSW 15 89387020 missense probably benign 0.00
R1815:Klhdc7b UTSW 15 89387597 missense probably damaging 0.99
R1893:Klhdc7b UTSW 15 89387695 unclassified probably null
R3508:Klhdc7b UTSW 15 89386892 start codon destroyed probably null 0.98
R3552:Klhdc7b UTSW 15 89387521 missense probably benign 0.02
R4001:Klhdc7b UTSW 15 89387984 missense probably damaging 1.00
R4618:Klhdc7b UTSW 15 89387269 missense probably benign 0.01
R4727:Klhdc7b UTSW 15 89387582 missense probably damaging 1.00
R5129:Klhdc7b UTSW 15 89388548 missense probably damaging 1.00
R5549:Klhdc7b UTSW 15 89387359 missense probably benign 0.01
R5643:Klhdc7b UTSW 15 89387659 missense possibly damaging 0.85
R5778:Klhdc7b UTSW 15 89387320 missense probably damaging 1.00
R5906:Klhdc7b UTSW 15 89387156 missense probably benign 0.02
R5942:Klhdc7b UTSW 15 89387431 missense probably benign 0.03
R6020:Klhdc7b UTSW 15 89388386 missense probably damaging 1.00
R6653:Klhdc7b UTSW 15 89387089 missense probably benign 0.00
R6810:Klhdc7b UTSW 15 89388356 missense possibly damaging 0.61
R7399:Klhdc7b UTSW 15 89388644 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- AGATCCTGTAGCAGACACTGAGCC -3'
(R):5'- GCTGAGCATCCTGCCTCATAGAAG -3'

Sequencing Primer
(F):5'- AATCTAATGTGGGCCTCTCCAAG -3'
(R):5'- TGCCTCATAGAAGTAGGCGG -3'
Posted On2013-11-07