Incidental Mutation 'R0971:Glyr1'
ID81517
Institutional Source Beutler Lab
Gene Symbol Glyr1
Ensembl Gene ENSMUSG00000022536
Gene Nameglyoxylate reductase 1 homolog (Arabidopsis)
Synonyms3930401K13Rik, Npac, 2810419J22Rik
MMRRC Submission 039100-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.398) question?
Stock #R0971 (G1)
Quality Score121
Status Not validated
Chromosome16
Chromosomal Location5013909-5049863 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GCTGCC to G at 5021345 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023189] [ENSMUST00000115844]
Predicted Effect probably null
Transcript: ENSMUST00000023189
SMART Domains Protein: ENSMUSP00000023189
Gene: ENSMUSG00000022536

DomainStartEndE-ValueType
Pfam:PWWP 6 89 1.4e-24 PFAM
low complexity region 109 122 N/A INTRINSIC
AT_hook 167 179 3.21e-1 SMART
Pfam:NAD_binding_2 266 422 1.2e-36 PFAM
Pfam:F420_oxidored 268 355 2e-6 PFAM
Pfam:NAD_binding_11 423 544 2.7e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000115844
SMART Domains Protein: ENSMUSP00000111510
Gene: ENSMUSG00000022536

DomainStartEndE-ValueType
Pfam:PWWP 6 89 1.8e-24 PFAM
low complexity region 109 122 N/A INTRINSIC
AT_hook 167 179 3.21e-1 SMART
Pfam:NAD_binding_2 266 428 2.6e-41 PFAM
Pfam:F420_oxidored 268 361 3.2e-9 PFAM
Pfam:NAD_binding_11 429 550 3.4e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231132
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alpk3 G A 7: 81,092,579 E715K possibly damaging Het
Cbr2 T A 11: 120,730,433 I147F probably benign Het
Chdh A G 14: 30,033,663 N302S probably damaging Het
Cog5 T A 12: 31,919,678 H732Q probably benign Het
Itln1 C A 1: 171,529,204 V236F probably damaging Het
Itpr1 A G 6: 108,349,629 E104G possibly damaging Het
Kcnh8 T A 17: 52,725,899 F71L probably benign Het
Kif14 T C 1: 136,519,654 M1399T probably damaging Het
Kif21a A G 15: 90,940,581 V1324A possibly damaging Het
Klhdc7b A T 15: 89,387,054 H713L possibly damaging Het
Opn5 C T 17: 42,611,327 probably null Het
Poteg A T 8: 27,447,939 Y41F probably damaging Het
Prpmp5 T A 6: 132,313,655 D27V unknown Het
Psd2 C A 18: 35,979,786 T178K probably damaging Het
Ptch1 T C 13: 63,539,843 T374A probably benign Het
Rgma T C 7: 73,391,498 probably null Het
Tmem120a A G 5: 135,736,104 L272P probably damaging Het
Ugt2b38 T G 5: 87,412,373 N361H probably damaging Het
Vmn1r40 A T 6: 89,714,290 I30F probably benign Het
Vps33b A G 7: 80,287,899 D465G possibly damaging Het
Zan G A 5: 137,434,063 A2324V unknown Het
Other mutations in Glyr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01369:Glyr1 APN 16 5020288 missense probably benign
IGL02332:Glyr1 APN 16 5018953 missense probably damaging 1.00
IGL02407:Glyr1 APN 16 5036948 missense probably benign 0.01
IGL02429:Glyr1 APN 16 5019376 missense probably benign 0.28
IGL03255:Glyr1 APN 16 5048757 unclassified probably null
R0020:Glyr1 UTSW 16 5037049 missense probably damaging 1.00
R0309:Glyr1 UTSW 16 5031972 missense probably damaging 0.98
R0694:Glyr1 UTSW 16 5026560 missense probably damaging 0.99
R1347:Glyr1 UTSW 16 5021339 missense probably damaging 1.00
R1347:Glyr1 UTSW 16 5021339 missense probably damaging 1.00
R1382:Glyr1 UTSW 16 5021345 frame shift probably null
R1383:Glyr1 UTSW 16 5021345 frame shift probably null
R2137:Glyr1 UTSW 16 5018482 missense probably benign 0.01
R2254:Glyr1 UTSW 16 5019013 missense probably benign 0.01
R3913:Glyr1 UTSW 16 5031913 missense probably damaging 1.00
R4112:Glyr1 UTSW 16 5018486 missense possibly damaging 0.83
R4629:Glyr1 UTSW 16 5037043 missense possibly damaging 0.70
R4795:Glyr1 UTSW 16 5047758 missense probably benign 0.40
R5112:Glyr1 UTSW 16 5018876 nonsense probably null
R5412:Glyr1 UTSW 16 5036433 missense possibly damaging 0.87
R5757:Glyr1 UTSW 16 5018992 missense probably benign 0.30
R6425:Glyr1 UTSW 16 5036486 splice site probably null
Predicted Primers PCR Primer
(F):5'- GTTTCCCAAAAGGAGTTGGCCCAC -3'
(R):5'- AGCAGACACTGGCCTTGTGTGAAG -3'

Sequencing Primer
(F):5'- GGAGTTGGCCCACAGATG -3'
(R):5'- TCCTGCCTTGGGAAATCAGAC -3'
Posted On2013-11-07