Incidental Mutation 'R0918:Acp1'
ID81552
Institutional Source Beutler Lab
Gene Symbol Acp1
Ensembl Gene ENSMUSG00000044573
Gene Nameacid phosphatase 1, soluble
SynonymsLMW-PTP, 4632432E04Rik, Acp-1
MMRRC Submission 039068-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R0918 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location30893326-30911589 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 30905127 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 20 (S20*)
Ref Sequence ENSEMBL: ENSMUSP00000151833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062740] [ENSMUST00000074038] [ENSMUST00000219697]
Predicted Effect probably null
Transcript: ENSMUST00000062740
AA Change: S20*
SMART Domains Protein: ENSMUSP00000106509
Gene: ENSMUSG00000044573
AA Change: S20*

DomainStartEndE-ValueType
LMWPc 7 156 1.58e-68 SMART
Predicted Effect probably null
Transcript: ENSMUST00000074038
AA Change: S20*
SMART Domains Protein: ENSMUSP00000073686
Gene: ENSMUSG00000044573
AA Change: S20*

DomainStartEndE-ValueType
LMWPc 7 156 5.62e-74 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218696
Predicted Effect probably null
Transcript: ENSMUST00000219697
AA Change: S20*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222791
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.7%
  • 10x: 96.2%
  • 20x: 90.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the phosphotyrosine protein phosphatase family of proteins. It functions as an acid phosphatase and a protein tyrosine phosphatase by hydrolyzing protein tyrosine phosphate to protein tyrosine and orthophosphate. This enzyme also hydrolyzes orthophosphoric monoesters to alcohol and orthophosphate. This gene is genetically polymorphic, and three common alleles segregating at the corresponding locus give rise to six phenotypes. Each allele appears to encode at least two electrophoretically different isozymes, Bf and Bs, which are produced in allele-specific ratios. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a null allele show an increased mean serum IL-6 response to LPS challenge. Male homozygotes are smaller than controls whereas female homozygotes show an increased mean skin fibroblast proliferation rate. Males homozygous for a different null allele show decreased response of heart to induced stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadac T G 3: 60,039,532 I217R probably damaging Het
Adcy3 A G 12: 4,198,360 D474G probably benign Het
Apob T C 12: 7,983,941 I217T probably benign Het
Cdh12 G A 15: 21,492,599 V235I probably damaging Het
Cdhr5 T A 7: 141,272,149 T197S probably damaging Het
Cerkl A G 2: 79,333,629 I449T probably benign Het
Cpz A G 5: 35,517,654 Y84H probably damaging Het
Drosha T C 15: 12,842,533 probably null Het
Fbxo11 A T 17: 87,997,603 N613K probably damaging Het
Fes G T 7: 80,381,205 T536K probably damaging Het
Gm13941 G C 2: 111,100,600 T76R unknown Het
Lrp1 T C 10: 127,593,965 E412G probably damaging Het
Map3k12 T C 15: 102,503,852 I285V probably damaging Het
Map3k13 G A 16: 21,926,240 D850N probably damaging Het
Mapk4 C T 18: 73,970,337 V34M probably damaging Het
Morn1 T A 4: 155,087,471 W43R probably damaging Het
Ncan T G 8: 70,108,389 M643L possibly damaging Het
Npc1l1 G A 11: 6,218,239 T984M probably damaging Het
Olfr1441 A G 19: 12,423,235 K309E probably benign Het
Olfr301 A G 7: 86,413,195 T278A probably benign Het
Olfr467 T C 7: 107,815,211 I209T probably benign Het
Olfr987 A G 2: 85,331,932 probably benign Het
Pcdhb22 T C 18: 37,520,014 F255L probably damaging Het
Pi4ka T C 16: 17,285,260 D1697G possibly damaging Het
Pla2g12b A G 10: 59,421,484 D163G probably damaging Het
Pot1a G A 6: 25,756,268 T359M possibly damaging Het
Sass6 G A 3: 116,603,523 probably null Het
Scn1a C T 2: 66,323,307 probably null Het
Slc38a1 A G 15: 96,609,862 L103P probably damaging Het
Slc38a6 T A 12: 73,344,785 probably null Het
Smarca4 C T 9: 21,636,215 P265S probably benign Het
Snrpa1 A G 7: 66,070,615 T189A probably benign Het
Snx11 G A 11: 96,769,278 P195L possibly damaging Het
Spen T G 4: 141,485,564 I584L unknown Het
Sult2a5 T A 7: 13,625,409 H103Q probably benign Het
Syce1 T C 7: 140,780,523 K50E probably damaging Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tmem132a A G 19: 10,858,113 S1018P probably damaging Het
Other mutations in Acp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Acp1 APN 12 30897793 missense probably damaging 1.00
IGL00929:Acp1 APN 12 30904900 missense probably damaging 1.00
IGL01982:Acp1 APN 12 30911492 missense possibly damaging 0.77
IGL03012:Acp1 APN 12 30895949 missense probably benign 0.08
R1433:Acp1 UTSW 12 30895935 missense possibly damaging 0.75
R1797:Acp1 UTSW 12 30896114 critical splice donor site probably null
R1854:Acp1 UTSW 12 30897805 missense possibly damaging 0.68
R4843:Acp1 UTSW 12 30896145 nonsense probably null
R5225:Acp1 UTSW 12 30905079 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TGCTGTCAATGGCCCACTGTAAC -3'
(R):5'- TTGCCAACCTTAGATGCAGGCAC -3'

Sequencing Primer
(F):5'- CCCCACTTCATAGGTGGATGTAG -3'
(R):5'- ACTGGGCATCCACTTTGG -3'
Posted On2013-11-07